contestId int64 0 1.01k | index stringclasses 57 values | name stringlengths 2 58 | type stringclasses 2 values | rating int64 0 3.5k | tags listlengths 0 11 | title stringclasses 522 values | time-limit stringclasses 8 values | memory-limit stringclasses 8 values | problem-description stringlengths 0 7.15k | input-specification stringlengths 0 2.05k | output-specification stringlengths 0 1.5k | demo-input listlengths 0 7 | demo-output listlengths 0 7 | note stringlengths 0 5.24k | points float64 0 425k | test_cases listlengths 0 402 | creationTimeSeconds int64 1.37B 1.7B | relativeTimeSeconds int64 8 2.15B | programmingLanguage stringclasses 3 values | verdict stringclasses 14 values | testset stringclasses 12 values | passedTestCount int64 0 1k | timeConsumedMillis int64 0 15k | memoryConsumedBytes int64 0 805M | code stringlengths 3 65.5k | prompt stringlengths 262 8.2k | response stringlengths 17 65.5k | score float64 -1 3.99 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
75 | B | Facetook Priority Wall | PROGRAMMING | 1,500 | [
"expression parsing",
"implementation",
"strings"
] | B. Facetook Priority Wall | 2 | 256 | Facetook is a well known social network website, and it will launch a new feature called Facetook Priority Wall. This feature will sort all posts from your friends according to the priority factor (it will be described).
This priority factor will be affected by three types of actions:
- 1. "*X* posted on *Y*'s wall" (15 points), - 2. "*X* commented on *Y*'s post" (10 points), - 3. "*X* likes *Y*'s post" (5 points).
*X* and *Y* will be two distinct names. And each action will increase the priority factor between *X* and *Y* (and vice versa) by the above value of points (the priority factor between *X* and *Y* is the same as the priority factor between *Y* and *X*).
You will be given *n* actions with the above format (without the action number and the number of points), and you have to print all the distinct names in these actions sorted according to the priority factor with you. | The first line contains your name. The second line contains an integer *n*, which is the number of actions (1<=≤<=*n*<=≤<=100). Then *n* lines follow, it is guaranteed that each one contains exactly 1 action in the format given above. There is exactly one space between each two words in a line, and there are no extra spaces. All the letters are lowercase. All names in the input will consist of at least 1 letter and at most 10 small Latin letters. | Print *m* lines, where *m* is the number of distinct names in the input (excluding yourself). Each line should contain just 1 name. The names should be sorted according to the priority factor with you in the descending order (the highest priority factor should come first). If two or more names have the same priority factor, print them in the alphabetical (lexicographical) order.
Note, that you should output all the names that are present in the input data (excluding yourself), even if that person has a zero priority factor.
The lexicographical comparison is performed by the standard "<" operator in modern programming languages. The line *a* is lexicographically smaller than the line *b*, if either *a* is the prefix of *b*, or if exists such an *i* (1<=≤<=*i*<=≤<=*min*(|*a*|,<=|*b*|)), that *a**i*<=<<=*b**i*, and for any *j* (1<=≤<=*j*<=<<=*i*) *a**j*<==<=*b**j*, where |*a*| and |*b*| stand for the lengths of strings *a* and *b* correspondently. | [
"ahmed\n3\nahmed posted on fatma's wall\nfatma commented on ahmed's post\nmona likes ahmed's post\n",
"aba\n1\nlikes likes posted's post\n"
] | [
"fatma\nmona\n",
"likes\nposted\n"
] | none | 1,000 | [
{
"input": "ahmed\n3\nahmed posted on fatma's wall\nfatma commented on ahmed's post\nmona likes ahmed's post",
"output": "fatma\nmona"
},
{
"input": "aba\n1\nlikes likes posted's post",
"output": "likes\nposted"
},
{
"input": "nu\n5\ng commented on pwyndmh's post\nqv posted on g's wall\n... | 1,684,246,725 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 60 | 124 | 0 | class Chain:
def __init__(self, f, s):
self.f = f
self.s = s
me = input()
n = int(input())
mp = {}
for i in range(n):
a = list(map(str, input().split()))
if a[1] == "likes":
ot = a[2]
else:
ot = a[3]
# parse the name
her = ""
for j in range(len(ot)-2):
her += ot[j]
if me != a[0] and me != her:
try:
x = mp.get(a[0])
mp[a[0]] += 0
except:
mp[a[0]] = 0
try:
x = mp.get(her)
mp[her] += 0
except:
mp[her] = 0
continue
if a[1] == "posted":
try:
x = mp.get(a[0])
mp[a[0]] += 15
except:
mp[a[0]] = 15
try:
x = mp.get(a[0])
mp[her] += 15
except:
mp[her] = 15
elif a[1] == "commented":
try:
x = mp.get(a[0])
mp[a[0]] += 10
except:
mp[a[0]] = 10
try:
x = mp.get(a[0])
mp[her] += 10
except:
mp[her] = 10
else:
try:
x = mp.get(a[0])
mp[a[0]] += 5
except:
mp[a[0]] = 5
try:
x = mp.get(a[0])
mp[her] += 5
except:
mp[her] = 5
names = []
for i in mp:
if i != me:
names.append(Chain(mp[i], i))
l = sorted(names, key=lambda x: (-x.f, x.s))
for i in range(len(names)):
print(l[i].s)
| Title: Facetook Priority Wall
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Facetook is a well known social network website, and it will launch a new feature called Facetook Priority Wall. This feature will sort all posts from your friends according to the priority factor (it will be described).
This priority factor will be affected by three types of actions:
- 1. "*X* posted on *Y*'s wall" (15 points), - 2. "*X* commented on *Y*'s post" (10 points), - 3. "*X* likes *Y*'s post" (5 points).
*X* and *Y* will be two distinct names. And each action will increase the priority factor between *X* and *Y* (and vice versa) by the above value of points (the priority factor between *X* and *Y* is the same as the priority factor between *Y* and *X*).
You will be given *n* actions with the above format (without the action number and the number of points), and you have to print all the distinct names in these actions sorted according to the priority factor with you.
Input Specification:
The first line contains your name. The second line contains an integer *n*, which is the number of actions (1<=≤<=*n*<=≤<=100). Then *n* lines follow, it is guaranteed that each one contains exactly 1 action in the format given above. There is exactly one space between each two words in a line, and there are no extra spaces. All the letters are lowercase. All names in the input will consist of at least 1 letter and at most 10 small Latin letters.
Output Specification:
Print *m* lines, where *m* is the number of distinct names in the input (excluding yourself). Each line should contain just 1 name. The names should be sorted according to the priority factor with you in the descending order (the highest priority factor should come first). If two or more names have the same priority factor, print them in the alphabetical (lexicographical) order.
Note, that you should output all the names that are present in the input data (excluding yourself), even if that person has a zero priority factor.
The lexicographical comparison is performed by the standard "<" operator in modern programming languages. The line *a* is lexicographically smaller than the line *b*, if either *a* is the prefix of *b*, or if exists such an *i* (1<=≤<=*i*<=≤<=*min*(|*a*|,<=|*b*|)), that *a**i*<=<<=*b**i*, and for any *j* (1<=≤<=*j*<=<<=*i*) *a**j*<==<=*b**j*, where |*a*| and |*b*| stand for the lengths of strings *a* and *b* correspondently.
Demo Input:
["ahmed\n3\nahmed posted on fatma's wall\nfatma commented on ahmed's post\nmona likes ahmed's post\n", "aba\n1\nlikes likes posted's post\n"]
Demo Output:
['fatma\nmona\n', 'likes\nposted\n']
Note:
none | ```python
class Chain:
def __init__(self, f, s):
self.f = f
self.s = s
me = input()
n = int(input())
mp = {}
for i in range(n):
a = list(map(str, input().split()))
if a[1] == "likes":
ot = a[2]
else:
ot = a[3]
# parse the name
her = ""
for j in range(len(ot)-2):
her += ot[j]
if me != a[0] and me != her:
try:
x = mp.get(a[0])
mp[a[0]] += 0
except:
mp[a[0]] = 0
try:
x = mp.get(her)
mp[her] += 0
except:
mp[her] = 0
continue
if a[1] == "posted":
try:
x = mp.get(a[0])
mp[a[0]] += 15
except:
mp[a[0]] = 15
try:
x = mp.get(a[0])
mp[her] += 15
except:
mp[her] = 15
elif a[1] == "commented":
try:
x = mp.get(a[0])
mp[a[0]] += 10
except:
mp[a[0]] = 10
try:
x = mp.get(a[0])
mp[her] += 10
except:
mp[her] = 10
else:
try:
x = mp.get(a[0])
mp[a[0]] += 5
except:
mp[a[0]] = 5
try:
x = mp.get(a[0])
mp[her] += 5
except:
mp[her] = 5
names = []
for i in mp:
if i != me:
names.append(Chain(mp[i], i))
l = sorted(names, key=lambda x: (-x.f, x.s))
for i in range(len(names)):
print(l[i].s)
``` | 3.969 |
32 | B | Borze | PROGRAMMING | 800 | [
"expression parsing",
"implementation"
] | B. Borze | 2 | 256 | Ternary numeric notation is quite popular in Berland. To telegraph the ternary number the Borze alphabet is used. Digit 0 is transmitted as «.», 1 as «-.» and 2 as «--». You are to decode the Borze code, i.e. to find out the ternary number given its representation in Borze alphabet. | The first line contains a number in Borze code. The length of the string is between 1 and 200 characters. It's guaranteed that the given string is a valid Borze code of some ternary number (this number can have leading zeroes). | Output the decoded ternary number. It can have leading zeroes. | [
".-.--\n",
"--.\n",
"-..-.--\n"
] | [
"012",
"20",
"1012"
] | none | 1,000 | [
{
"input": ".-.--",
"output": "012"
},
{
"input": "--.",
"output": "20"
},
{
"input": "-..-.--",
"output": "1012"
},
{
"input": "---..",
"output": "210"
},
{
"input": "..--.---..",
"output": "0020210"
},
{
"input": "-.....----.",
"output": "1000022... | 1,649,009,325 | 2,147,483,647 | Python 3 | OK | TESTS | 30 | 92 | 0 | s = input()
def just_print(s):
print(s, sep = "", end = "")
dashed = False
for c in s:
if dashed:
dashed = False
if c == '.':
just_print(1)
elif c == '-':
just_print(2)
elif c == '-':
dashed = True
else:
just_print(0) | Title: Borze
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Ternary numeric notation is quite popular in Berland. To telegraph the ternary number the Borze alphabet is used. Digit 0 is transmitted as «.», 1 as «-.» and 2 as «--». You are to decode the Borze code, i.e. to find out the ternary number given its representation in Borze alphabet.
Input Specification:
The first line contains a number in Borze code. The length of the string is between 1 and 200 characters. It's guaranteed that the given string is a valid Borze code of some ternary number (this number can have leading zeroes).
Output Specification:
Output the decoded ternary number. It can have leading zeroes.
Demo Input:
['.-.--\n', '--.\n', '-..-.--\n']
Demo Output:
['012', '20', '1012']
Note:
none | ```python
s = input()
def just_print(s):
print(s, sep = "", end = "")
dashed = False
for c in s:
if dashed:
dashed = False
if c == '.':
just_print(1)
elif c == '-':
just_print(2)
elif c == '-':
dashed = True
else:
just_print(0)
``` | 3.977 |
707 | A | Brain's Photos | PROGRAMMING | 800 | [
"implementation"
] | null | null | Small, but very brave, mouse Brain was not accepted to summer school of young villains. He was upset and decided to postpone his plans of taking over the world, but to become a photographer instead.
As you may know, the coolest photos are on the film (because you can specify the hashtag #film for such).
Brain took a lot of colourful pictures on colored and black-and-white film. Then he developed and translated it into a digital form. But now, color and black-and-white photos are in one folder, and to sort them, one needs to spend more than one hour!
As soon as Brain is a photographer not programmer now, he asks you to help him determine for a single photo whether it is colored or black-and-white.
Photo can be represented as a matrix sized *n*<=×<=*m*, and each element of the matrix stores a symbol indicating corresponding pixel color. There are only 6 colors:
- 'C' (cyan)- 'M' (magenta)- 'Y' (yellow)- 'W' (white)- 'G' (grey)- 'B' (black)
The photo is considered black-and-white if it has only white, black and grey pixels in it. If there are any of cyan, magenta or yellow pixels in the photo then it is considered colored. | The first line of the input contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100) — the number of photo pixel matrix rows and columns respectively.
Then *n* lines describing matrix rows follow. Each of them contains *m* space-separated characters describing colors of pixels in a row. Each character in the line is one of the 'C', 'M', 'Y', 'W', 'G' or 'B'. | Print the "#Black&White" (without quotes), if the photo is black-and-white and "#Color" (without quotes), if it is colored, in the only line. | [
"2 2\nC M\nY Y\n",
"3 2\nW W\nW W\nB B\n",
"1 1\nW\n"
] | [
"#Color",
"#Black&White",
"#Black&White"
] | none | 500 | [
{
"input": "2 2\nC M\nY Y",
"output": "#Color"
},
{
"input": "3 2\nW W\nW W\nB B",
"output": "#Black&White"
},
{
"input": "1 1\nW",
"output": "#Black&White"
},
{
"input": "2 3\nW W W\nB G Y",
"output": "#Color"
},
{
"input": "1 1\nW",
"output": "#Black&White"
... | 1,692,955,733 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 15 | 0 | m,n = map(int,input().split())
a = []
for i in range(m):
a.append([str(j) for j in input().split()])
s=set()
for i in range(m):
for j in range (n):
s.add(a[i][j])
if "C" in s or "M" in s or "Y" in s or "G" in s:
print("#Color")
print(s)
else:
print("#Black&White") | Title: Brain's Photos
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Small, but very brave, mouse Brain was not accepted to summer school of young villains. He was upset and decided to postpone his plans of taking over the world, but to become a photographer instead.
As you may know, the coolest photos are on the film (because you can specify the hashtag #film for such).
Brain took a lot of colourful pictures on colored and black-and-white film. Then he developed and translated it into a digital form. But now, color and black-and-white photos are in one folder, and to sort them, one needs to spend more than one hour!
As soon as Brain is a photographer not programmer now, he asks you to help him determine for a single photo whether it is colored or black-and-white.
Photo can be represented as a matrix sized *n*<=×<=*m*, and each element of the matrix stores a symbol indicating corresponding pixel color. There are only 6 colors:
- 'C' (cyan)- 'M' (magenta)- 'Y' (yellow)- 'W' (white)- 'G' (grey)- 'B' (black)
The photo is considered black-and-white if it has only white, black and grey pixels in it. If there are any of cyan, magenta or yellow pixels in the photo then it is considered colored.
Input Specification:
The first line of the input contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100) — the number of photo pixel matrix rows and columns respectively.
Then *n* lines describing matrix rows follow. Each of them contains *m* space-separated characters describing colors of pixels in a row. Each character in the line is one of the 'C', 'M', 'Y', 'W', 'G' or 'B'.
Output Specification:
Print the "#Black&White" (without quotes), if the photo is black-and-white and "#Color" (without quotes), if it is colored, in the only line.
Demo Input:
['2 2\nC M\nY Y\n', '3 2\nW W\nW W\nB B\n', '1 1\nW\n']
Demo Output:
['#Color', '#Black&White', '#Black&White']
Note:
none | ```python
m,n = map(int,input().split())
a = []
for i in range(m):
a.append([str(j) for j in input().split()])
s=set()
for i in range(m):
for j in range (n):
s.add(a[i][j])
if "C" in s or "M" in s or "Y" in s or "G" in s:
print("#Color")
print(s)
else:
print("#Black&White")
``` | 0 | |
379 | A | New Year Candles | PROGRAMMING | 1,000 | [
"implementation"
] | null | null | Vasily the Programmer loves romance, so this year he decided to illuminate his room with candles.
Vasily has *a* candles.When Vasily lights up a new candle, it first burns for an hour and then it goes out. Vasily is smart, so he can make *b* went out candles into a new candle. As a result, this new candle can be used like any other new candle.
Now Vasily wonders: for how many hours can his candles light up the room if he acts optimally well? Help him find this number. | The single line contains two integers, *a* and *b* (1<=≤<=*a*<=≤<=1000; 2<=≤<=*b*<=≤<=1000). | Print a single integer — the number of hours Vasily can light up the room for. | [
"4 2\n",
"6 3\n"
] | [
"7\n",
"8\n"
] | Consider the first sample. For the first four hours Vasily lights up new candles, then he uses four burned out candles to make two new ones and lights them up. When these candles go out (stop burning), Vasily can make another candle. Overall, Vasily can light up the room for 7 hours. | 500 | [
{
"input": "4 2",
"output": "7"
},
{
"input": "6 3",
"output": "8"
},
{
"input": "1000 1000",
"output": "1001"
},
{
"input": "123 5",
"output": "153"
},
{
"input": "1000 2",
"output": "1999"
},
{
"input": "1 2",
"output": "1"
},
{
"input": ... | 1,693,578,358 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 4 | 31 | 0 | a,b=list(map(int,input().split(" ")))
res=a
li=res
while(li>=b):
li/=b
res+=round(li)
print(res) | Title: New Year Candles
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasily the Programmer loves romance, so this year he decided to illuminate his room with candles.
Vasily has *a* candles.When Vasily lights up a new candle, it first burns for an hour and then it goes out. Vasily is smart, so he can make *b* went out candles into a new candle. As a result, this new candle can be used like any other new candle.
Now Vasily wonders: for how many hours can his candles light up the room if he acts optimally well? Help him find this number.
Input Specification:
The single line contains two integers, *a* and *b* (1<=≤<=*a*<=≤<=1000; 2<=≤<=*b*<=≤<=1000).
Output Specification:
Print a single integer — the number of hours Vasily can light up the room for.
Demo Input:
['4 2\n', '6 3\n']
Demo Output:
['7\n', '8\n']
Note:
Consider the first sample. For the first four hours Vasily lights up new candles, then he uses four burned out candles to make two new ones and lights them up. When these candles go out (stop burning), Vasily can make another candle. Overall, Vasily can light up the room for 7 hours. | ```python
a,b=list(map(int,input().split(" ")))
res=a
li=res
while(li>=b):
li/=b
res+=round(li)
print(res)
``` | 0 | |
0 | none | none | none | 0 | [
"none"
] | null | null | In order to put away old things and welcome a fresh new year, a thorough cleaning of the house is a must.
Little Tommy finds an old polynomial and cleaned it up by taking it modulo another. But now he regrets doing this...
Given two integers *p* and *k*, find a polynomial *f*(*x*) with non-negative integer coefficients strictly less than *k*, whose remainder is *p* when divided by (*x*<=+<=*k*). That is, *f*(*x*)<==<=*q*(*x*)·(*x*<=+<=*k*)<=+<=*p*, where *q*(*x*) is a polynomial (not necessarily with integer coefficients). | The only line of input contains two space-separated integers *p* and *k* (1<=≤<=*p*<=≤<=1018, 2<=≤<=*k*<=≤<=2<=000). | If the polynomial does not exist, print a single integer -1, or output two lines otherwise.
In the first line print a non-negative integer *d* — the number of coefficients in the polynomial.
In the second line print *d* space-separated integers *a*0,<=*a*1,<=...,<=*a**d*<=-<=1, describing a polynomial fulfilling the given requirements. Your output should satisfy 0<=≤<=*a**i*<=<<=*k* for all 0<=≤<=*i*<=≤<=*d*<=-<=1, and *a**d*<=-<=1<=≠<=0.
If there are many possible solutions, print any of them. | [
"46 2\n",
"2018 214\n"
] | [
"7\n0 1 0 0 1 1 1\n",
"3\n92 205 1\n"
] | In the first example, *f*(*x*) = *x*<sup class="upper-index">6</sup> + *x*<sup class="upper-index">5</sup> + *x*<sup class="upper-index">4</sup> + *x* = (*x*<sup class="upper-index">5</sup> - *x*<sup class="upper-index">4</sup> + 3*x*<sup class="upper-index">3</sup> - 6*x*<sup class="upper-index">2</sup> + 12*x* - 23)·(*x* + 2) + 46.
In the second example, *f*(*x*) = *x*<sup class="upper-index">2</sup> + 205*x* + 92 = (*x* - 9)·(*x* + 214) + 2018. | 0 | [
{
"input": "46 2",
"output": "7\n0 1 0 0 1 1 1"
},
{
"input": "2018 214",
"output": "3\n92 205 1"
},
{
"input": "4 2",
"output": "3\n0 0 1"
},
{
"input": "5 2",
"output": "3\n1 0 1"
},
{
"input": "10 3",
"output": "3\n1 0 1"
},
{
"input": "250 1958",
... | 1,518,615,190 | 5,290 | PyPy 3 | WRONG_ANSWER | PRETESTS | 5 | 77 | 19,968,000 | # import sys
# sys.stdin = open('in.txt', 'r')
p, k = map(int, input().split())
b = []
for i in range(200):
if i == 0:
if p%k == 0:
b.append(-p//k)
else:
b.append(-p//k+1)
else:
if b[i-1]%k == 0:
b.append(-b[i-1]//k)
else:
b.append(-b[i-1]//k+1)
if b[-1] == 0:
b.pop()
break
# print(b)
if(len(b) == 0):
print(-1)
exit(0)
a = []
for i in range(len(b)):
if i == 0:
a.append(k*b[i]+p)
else:
a.append(k*b[i]+b[i-1])
a.append(b[-1])
if all(map(lambda x: x < k, a)):
print(len(a))
print(' '.join(map(str, a)))
else:
print(-1)
#
# b[2] b[1] b[0]
# kb[2] kb[1] kb[0]+p
#
# 0 <= b[1] + kb[2] < k
# 0 <= b[0] + kb[1] < k
# 0 <= kb[0] + p < k
#
# -p/k <= b[0] < (k-p)/k
# -b[0]/k <= b[1] < (k-b[0])/k
# -b[1]/k <= b[2] < (k-b[1])/k
# 0 <= b[2] < k
#
# -p/k <= b[0] < -p/k + 1
# -b[0]/k <= b[1] < -b[0]/k + 1
| Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
In order to put away old things and welcome a fresh new year, a thorough cleaning of the house is a must.
Little Tommy finds an old polynomial and cleaned it up by taking it modulo another. But now he regrets doing this...
Given two integers *p* and *k*, find a polynomial *f*(*x*) with non-negative integer coefficients strictly less than *k*, whose remainder is *p* when divided by (*x*<=+<=*k*). That is, *f*(*x*)<==<=*q*(*x*)·(*x*<=+<=*k*)<=+<=*p*, where *q*(*x*) is a polynomial (not necessarily with integer coefficients).
Input Specification:
The only line of input contains two space-separated integers *p* and *k* (1<=≤<=*p*<=≤<=1018, 2<=≤<=*k*<=≤<=2<=000).
Output Specification:
If the polynomial does not exist, print a single integer -1, or output two lines otherwise.
In the first line print a non-negative integer *d* — the number of coefficients in the polynomial.
In the second line print *d* space-separated integers *a*0,<=*a*1,<=...,<=*a**d*<=-<=1, describing a polynomial fulfilling the given requirements. Your output should satisfy 0<=≤<=*a**i*<=<<=*k* for all 0<=≤<=*i*<=≤<=*d*<=-<=1, and *a**d*<=-<=1<=≠<=0.
If there are many possible solutions, print any of them.
Demo Input:
['46 2\n', '2018 214\n']
Demo Output:
['7\n0 1 0 0 1 1 1\n', '3\n92 205 1\n']
Note:
In the first example, *f*(*x*) = *x*<sup class="upper-index">6</sup> + *x*<sup class="upper-index">5</sup> + *x*<sup class="upper-index">4</sup> + *x* = (*x*<sup class="upper-index">5</sup> - *x*<sup class="upper-index">4</sup> + 3*x*<sup class="upper-index">3</sup> - 6*x*<sup class="upper-index">2</sup> + 12*x* - 23)·(*x* + 2) + 46.
In the second example, *f*(*x*) = *x*<sup class="upper-index">2</sup> + 205*x* + 92 = (*x* - 9)·(*x* + 214) + 2018. | ```python
# import sys
# sys.stdin = open('in.txt', 'r')
p, k = map(int, input().split())
b = []
for i in range(200):
if i == 0:
if p%k == 0:
b.append(-p//k)
else:
b.append(-p//k+1)
else:
if b[i-1]%k == 0:
b.append(-b[i-1]//k)
else:
b.append(-b[i-1]//k+1)
if b[-1] == 0:
b.pop()
break
# print(b)
if(len(b) == 0):
print(-1)
exit(0)
a = []
for i in range(len(b)):
if i == 0:
a.append(k*b[i]+p)
else:
a.append(k*b[i]+b[i-1])
a.append(b[-1])
if all(map(lambda x: x < k, a)):
print(len(a))
print(' '.join(map(str, a)))
else:
print(-1)
#
# b[2] b[1] b[0]
# kb[2] kb[1] kb[0]+p
#
# 0 <= b[1] + kb[2] < k
# 0 <= b[0] + kb[1] < k
# 0 <= kb[0] + p < k
#
# -p/k <= b[0] < (k-p)/k
# -b[0]/k <= b[1] < (k-b[0])/k
# -b[1]/k <= b[2] < (k-b[1])/k
# 0 <= b[2] < k
#
# -p/k <= b[0] < -p/k + 1
# -b[0]/k <= b[1] < -b[0]/k + 1
``` | 0 | |
902 | A | Visiting a Friend | PROGRAMMING | 1,100 | [
"greedy",
"implementation"
] | null | null | Pig is visiting a friend.
Pig's house is located at point 0, and his friend's house is located at point *m* on an axis.
Pig can use teleports to move along the axis.
To use a teleport, Pig should come to a certain point (where the teleport is located) and choose where to move: for each teleport there is the rightmost point it can move Pig to, this point is known as the limit of the teleport.
Formally, a teleport located at point *x* with limit *y* can move Pig from point *x* to any point within the segment [*x*;<=*y*], including the bounds.
Determine if Pig can visit the friend using teleports only, or he should use his car. | The first line contains two integers *n* and *m* (1<=≤<=*n*<=≤<=100,<=1<=≤<=*m*<=≤<=100) — the number of teleports and the location of the friend's house.
The next *n* lines contain information about teleports.
The *i*-th of these lines contains two integers *a**i* and *b**i* (0<=≤<=*a**i*<=≤<=*b**i*<=≤<=*m*), where *a**i* is the location of the *i*-th teleport, and *b**i* is its limit.
It is guaranteed that *a**i*<=≥<=*a**i*<=-<=1 for every *i* (2<=≤<=*i*<=≤<=*n*). | Print "YES" if there is a path from Pig's house to his friend's house that uses only teleports, and "NO" otherwise.
You can print each letter in arbitrary case (upper or lower). | [
"3 5\n0 2\n2 4\n3 5\n",
"3 7\n0 4\n2 5\n6 7\n"
] | [
"YES\n",
"NO\n"
] | The first example is shown on the picture below:
Pig can use the first teleport from his house (point 0) to reach point 2, then using the second teleport go from point 2 to point 3, then using the third teleport go from point 3 to point 5, where his friend lives.
The second example is shown on the picture below:
You can see that there is no path from Pig's house to his friend's house that uses only teleports. | 500 | [
{
"input": "3 5\n0 2\n2 4\n3 5",
"output": "YES"
},
{
"input": "3 7\n0 4\n2 5\n6 7",
"output": "NO"
},
{
"input": "1 1\n0 0",
"output": "NO"
},
{
"input": "30 10\n0 7\n1 2\n1 2\n1 4\n1 4\n1 3\n2 2\n2 4\n2 6\n2 9\n2 2\n3 5\n3 8\n4 8\n4 5\n4 6\n5 6\n5 7\n6 6\n6 9\n6 7\n6 9\n7 7... | 1,513,915,688 | 1,088 | Python 3 | OK | TESTS | 55 | 62 | 5,632,000 |
n, m = map(int, input().split())
cur = 0
for _ in range(n):
x, y = map(int, input().split())
if (x <= cur):
cur = max(cur,y)
if (cur >= m):
print("YES")
else:
print("NO") | Title: Visiting a Friend
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Pig is visiting a friend.
Pig's house is located at point 0, and his friend's house is located at point *m* on an axis.
Pig can use teleports to move along the axis.
To use a teleport, Pig should come to a certain point (where the teleport is located) and choose where to move: for each teleport there is the rightmost point it can move Pig to, this point is known as the limit of the teleport.
Formally, a teleport located at point *x* with limit *y* can move Pig from point *x* to any point within the segment [*x*;<=*y*], including the bounds.
Determine if Pig can visit the friend using teleports only, or he should use his car.
Input Specification:
The first line contains two integers *n* and *m* (1<=≤<=*n*<=≤<=100,<=1<=≤<=*m*<=≤<=100) — the number of teleports and the location of the friend's house.
The next *n* lines contain information about teleports.
The *i*-th of these lines contains two integers *a**i* and *b**i* (0<=≤<=*a**i*<=≤<=*b**i*<=≤<=*m*), where *a**i* is the location of the *i*-th teleport, and *b**i* is its limit.
It is guaranteed that *a**i*<=≥<=*a**i*<=-<=1 for every *i* (2<=≤<=*i*<=≤<=*n*).
Output Specification:
Print "YES" if there is a path from Pig's house to his friend's house that uses only teleports, and "NO" otherwise.
You can print each letter in arbitrary case (upper or lower).
Demo Input:
['3 5\n0 2\n2 4\n3 5\n', '3 7\n0 4\n2 5\n6 7\n']
Demo Output:
['YES\n', 'NO\n']
Note:
The first example is shown on the picture below:
Pig can use the first teleport from his house (point 0) to reach point 2, then using the second teleport go from point 2 to point 3, then using the third teleport go from point 3 to point 5, where his friend lives.
The second example is shown on the picture below:
You can see that there is no path from Pig's house to his friend's house that uses only teleports. | ```python
n, m = map(int, input().split())
cur = 0
for _ in range(n):
x, y = map(int, input().split())
if (x <= cur):
cur = max(cur,y)
if (cur >= m):
print("YES")
else:
print("NO")
``` | 3 | |
987 | A | Infinity Gauntlet | PROGRAMMING | 800 | [
"implementation"
] | null | null | You took a peek on Thanos wearing Infinity Gauntlet. In the Gauntlet there is a place for six Infinity Gems:
- the Power Gem of purple color, - the Time Gem of green color, - the Space Gem of blue color, - the Soul Gem of orange color, - the Reality Gem of red color, - the Mind Gem of yellow color.
Using colors of Gems you saw in the Gauntlet determine the names of absent Gems. | In the first line of input there is one integer $n$ ($0 \le n \le 6$) — the number of Gems in Infinity Gauntlet.
In next $n$ lines there are colors of Gems you saw. Words used for colors are: purple, green, blue, orange, red, yellow. It is guaranteed that all the colors are distinct. All colors are given in lowercase English letters. | In the first line output one integer $m$ ($0 \le m \le 6$) — the number of absent Gems.
Then in $m$ lines print the names of absent Gems, each on its own line. Words used for names are: Power, Time, Space, Soul, Reality, Mind. Names can be printed in any order. Keep the first letter uppercase, others lowercase. | [
"4\nred\npurple\nyellow\norange\n",
"0\n"
] | [
"2\nSpace\nTime\n",
"6\nTime\nMind\nSoul\nPower\nReality\nSpace\n"
] | In the first sample Thanos already has Reality, Power, Mind and Soul Gems, so he needs two more: Time and Space.
In the second sample Thanos doesn't have any Gems, so he needs all six. | 500 | [
{
"input": "4\nred\npurple\nyellow\norange",
"output": "2\nSpace\nTime"
},
{
"input": "0",
"output": "6\nMind\nSpace\nPower\nTime\nReality\nSoul"
},
{
"input": "6\npurple\nblue\nyellow\nred\ngreen\norange",
"output": "0"
},
{
"input": "1\npurple",
"output": "5\nTime\nReal... | 1,579,467,619 | 2,147,483,647 | Python 3 | OK | TESTS | 64 | 109 | 307,200 | n = int(input())
gems = { 'purple': 'Power', 'green':'Time', 'blue':'Space', 'orange':'Soul', 'red':'Reality', 'yellow':'Mind' }
count = 6
missing = [ 'Power', 'Time', 'Space', 'Soul', 'Reality', 'Mind']
for _ in range(n):
s = input()
missing.remove(gems[s])
count -= 1
print(count)
for _ in missing:
print(_) | Title: Infinity Gauntlet
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You took a peek on Thanos wearing Infinity Gauntlet. In the Gauntlet there is a place for six Infinity Gems:
- the Power Gem of purple color, - the Time Gem of green color, - the Space Gem of blue color, - the Soul Gem of orange color, - the Reality Gem of red color, - the Mind Gem of yellow color.
Using colors of Gems you saw in the Gauntlet determine the names of absent Gems.
Input Specification:
In the first line of input there is one integer $n$ ($0 \le n \le 6$) — the number of Gems in Infinity Gauntlet.
In next $n$ lines there are colors of Gems you saw. Words used for colors are: purple, green, blue, orange, red, yellow. It is guaranteed that all the colors are distinct. All colors are given in lowercase English letters.
Output Specification:
In the first line output one integer $m$ ($0 \le m \le 6$) — the number of absent Gems.
Then in $m$ lines print the names of absent Gems, each on its own line. Words used for names are: Power, Time, Space, Soul, Reality, Mind. Names can be printed in any order. Keep the first letter uppercase, others lowercase.
Demo Input:
['4\nred\npurple\nyellow\norange\n', '0\n']
Demo Output:
['2\nSpace\nTime\n', '6\nTime\nMind\nSoul\nPower\nReality\nSpace\n']
Note:
In the first sample Thanos already has Reality, Power, Mind and Soul Gems, so he needs two more: Time and Space.
In the second sample Thanos doesn't have any Gems, so he needs all six. | ```python
n = int(input())
gems = { 'purple': 'Power', 'green':'Time', 'blue':'Space', 'orange':'Soul', 'red':'Reality', 'yellow':'Mind' }
count = 6
missing = [ 'Power', 'Time', 'Space', 'Soul', 'Reality', 'Mind']
for _ in range(n):
s = input()
missing.remove(gems[s])
count -= 1
print(count)
for _ in missing:
print(_)
``` | 3 | |
320 | B | Ping-Pong (Easy Version) | PROGRAMMING | 1,500 | [
"dfs and similar",
"graphs"
] | null | null | In this problem at each moment you have a set of intervals. You can move from interval (*a*,<=*b*) from our set to interval (*c*,<=*d*) from our set if and only if *c*<=<<=*a*<=<<=*d* or *c*<=<<=*b*<=<<=*d*. Also there is a path from interval *I*1 from our set to interval *I*2 from our set if there is a sequence of successive moves starting from *I*1 so that we can reach *I*2.
Your program should handle the queries of the following two types:
1. "1 x y" (*x*<=<<=*y*) — add the new interval (*x*,<=*y*) to the set of intervals. The length of the new interval is guaranteed to be strictly greater than all the previous intervals.1. "2 a b" (*a*<=≠<=*b*) — answer the question: is there a path from *a*-th (one-based) added interval to *b*-th (one-based) added interval?
Answer all the queries. Note, that initially you have an empty set of intervals. | The first line of the input contains integer *n* denoting the number of queries, (1<=≤<=*n*<=≤<=100). Each of the following lines contains a query as described above. All numbers in the input are integers and don't exceed 109 by their absolute value.
It's guaranteed that all queries are correct. | For each query of the second type print "YES" or "NO" on a separate line depending on the answer. | [
"5\n1 1 5\n1 5 11\n2 1 2\n1 2 9\n2 1 2\n"
] | [
"NO\nYES\n"
] | none | 1,000 | [
{
"input": "5\n1 1 5\n1 5 11\n2 1 2\n1 2 9\n2 1 2",
"output": "NO\nYES"
},
{
"input": "10\n1 -311 -186\n1 -1070 -341\n1 -1506 -634\n1 688 1698\n2 2 4\n1 70 1908\n2 1 2\n2 2 4\n1 -1053 1327\n2 5 4",
"output": "NO\nNO\nNO\nYES"
},
{
"input": "10\n1 -1365 -865\n1 1244 1834\n2 1 2\n1 -1508 -... | 1,632,476,836 | 2,147,483,647 | PyPy 3 | WRONG_ANSWER | TESTS | 3 | 124 | 20,172,800 | def dfs(adj, vis, v):
global flag
vis[v] = True
for u in adj[v]:
if not vis[u]:
dfs(adj, vis, u)
n = int(input())
adj = []
intervals = []
icount = 0
for _ in range(n):
query = [int(x) for x in input().split()]
if query[0] == 1:
ls, x, y = [], query[1], query[2]
for i, (x1, y1) in enumerate(intervals):
if x < x1 < y or x < y1 < y:
ls.append(i)
if x1 < x < y1 or x1 < y < y1:
adj[i].append(icount)
adj.append(ls)
icount += 1
intervals.append((x, y))
else:
a, b = query[1], query[2]
vis = [False] * len(intervals)
dfs(adj, vis, a - 1)
print('YES' if vis[b - 1] else 'NO')
# print(adj)
| Title: Ping-Pong (Easy Version)
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
In this problem at each moment you have a set of intervals. You can move from interval (*a*,<=*b*) from our set to interval (*c*,<=*d*) from our set if and only if *c*<=<<=*a*<=<<=*d* or *c*<=<<=*b*<=<<=*d*. Also there is a path from interval *I*1 from our set to interval *I*2 from our set if there is a sequence of successive moves starting from *I*1 so that we can reach *I*2.
Your program should handle the queries of the following two types:
1. "1 x y" (*x*<=<<=*y*) — add the new interval (*x*,<=*y*) to the set of intervals. The length of the new interval is guaranteed to be strictly greater than all the previous intervals.1. "2 a b" (*a*<=≠<=*b*) — answer the question: is there a path from *a*-th (one-based) added interval to *b*-th (one-based) added interval?
Answer all the queries. Note, that initially you have an empty set of intervals.
Input Specification:
The first line of the input contains integer *n* denoting the number of queries, (1<=≤<=*n*<=≤<=100). Each of the following lines contains a query as described above. All numbers in the input are integers and don't exceed 109 by their absolute value.
It's guaranteed that all queries are correct.
Output Specification:
For each query of the second type print "YES" or "NO" on a separate line depending on the answer.
Demo Input:
['5\n1 1 5\n1 5 11\n2 1 2\n1 2 9\n2 1 2\n']
Demo Output:
['NO\nYES\n']
Note:
none | ```python
def dfs(adj, vis, v):
global flag
vis[v] = True
for u in adj[v]:
if not vis[u]:
dfs(adj, vis, u)
n = int(input())
adj = []
intervals = []
icount = 0
for _ in range(n):
query = [int(x) for x in input().split()]
if query[0] == 1:
ls, x, y = [], query[1], query[2]
for i, (x1, y1) in enumerate(intervals):
if x < x1 < y or x < y1 < y:
ls.append(i)
if x1 < x < y1 or x1 < y < y1:
adj[i].append(icount)
adj.append(ls)
icount += 1
intervals.append((x, y))
else:
a, b = query[1], query[2]
vis = [False] * len(intervals)
dfs(adj, vis, a - 1)
print('YES' if vis[b - 1] else 'NO')
# print(adj)
``` | 0 | |
644 | C | Hostname Aliases | PROGRAMMING | 2,100 | [
"*special",
"binary search",
"data structures",
"implementation",
"sortings",
"strings"
] | null | null | There are some websites that are accessible through several different addresses. For example, for a long time Codeforces was accessible with two hostnames codeforces.com and codeforces.ru.
You are given a list of page addresses being queried. For simplicity we consider all addresses to have the form http://<hostname>[/<path>], where:
- <hostname> — server name (consists of words and maybe some dots separating them), - /<path> — optional part, where <path> consists of words separated by slashes.
We consider two <hostname> to correspond to one website if for each query to the first <hostname> there will be exactly the same query to the second one and vice versa — for each query to the second <hostname> there will be the same query to the first one. Take a look at the samples for further clarifications.
Your goal is to determine the groups of server names that correspond to one website. Ignore groups consisting of the only server name.
Please note, that according to the above definition queries http://<hostname> and http://<hostname>/ are different. | The first line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=100<=000) — the number of page queries. Then follow *n* lines each containing exactly one address. Each address is of the form http://<hostname>[/<path>], where:
- <hostname> consists of lowercase English letters and dots, there are no two consecutive dots, <hostname> doesn't start or finish with a dot. The length of <hostname> is positive and doesn't exceed 20. - <path> consists of lowercase English letters, dots and slashes. There are no two consecutive slashes, <path> doesn't start with a slash and its length doesn't exceed 20.
Addresses are not guaranteed to be distinct. | First print *k* — the number of groups of server names that correspond to one website. You should count only groups of size greater than one.
Next *k* lines should contain the description of groups, one group per line. For each group print all server names separated by a single space. You are allowed to print both groups and names inside any group in arbitrary order. | [
"10\nhttp://abacaba.ru/test\nhttp://abacaba.ru/\nhttp://abacaba.com\nhttp://abacaba.com/test\nhttp://abacaba.de/\nhttp://abacaba.ru/test\nhttp://abacaba.de/test\nhttp://abacaba.com/\nhttp://abacaba.com/t\nhttp://abacaba.com/test\n",
"14\nhttp://c\nhttp://ccc.bbbb/aba..b\nhttp://cba.com\nhttp://a.c/aba..b/a\nhttp:... | [
"1\nhttp://abacaba.de http://abacaba.ru \n",
"2\nhttp://cba.com http://ccc.bbbb \nhttp://a.a.a http://a.c http://abc \n"
] | none | 1,500 | [
{
"input": "10\nhttp://abacaba.ru/test\nhttp://abacaba.ru/\nhttp://abacaba.com\nhttp://abacaba.com/test\nhttp://abacaba.de/\nhttp://abacaba.ru/test\nhttp://abacaba.de/test\nhttp://abacaba.com/\nhttp://abacaba.com/t\nhttp://abacaba.com/test",
"output": "1\nhttp://abacaba.de http://abacaba.ru "
},
{
"... | 1,458,163,851 | 45,051 | Python 3 | WRONG_ANSWER | PRETESTS | 0 | 46 | 0 | n = int(input())
w = {}
for g in range(n):
s = input().split('/')
s[2] = 'http://' + s[2]
if not(w.get(s[2])):
w[s[2]] = set(s[3:])
else:
w[s[2]] = w[s[2]].union(s[3:])
bad = set()
for name, s in w.items():
bad.add(name)
for name2, s2 in w.items():
if name2 in bad: continue
if s == s2: print(name, name2) | Title: Hostname Aliases
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There are some websites that are accessible through several different addresses. For example, for a long time Codeforces was accessible with two hostnames codeforces.com and codeforces.ru.
You are given a list of page addresses being queried. For simplicity we consider all addresses to have the form http://<hostname>[/<path>], where:
- <hostname> — server name (consists of words and maybe some dots separating them), - /<path> — optional part, where <path> consists of words separated by slashes.
We consider two <hostname> to correspond to one website if for each query to the first <hostname> there will be exactly the same query to the second one and vice versa — for each query to the second <hostname> there will be the same query to the first one. Take a look at the samples for further clarifications.
Your goal is to determine the groups of server names that correspond to one website. Ignore groups consisting of the only server name.
Please note, that according to the above definition queries http://<hostname> and http://<hostname>/ are different.
Input Specification:
The first line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=100<=000) — the number of page queries. Then follow *n* lines each containing exactly one address. Each address is of the form http://<hostname>[/<path>], where:
- <hostname> consists of lowercase English letters and dots, there are no two consecutive dots, <hostname> doesn't start or finish with a dot. The length of <hostname> is positive and doesn't exceed 20. - <path> consists of lowercase English letters, dots and slashes. There are no two consecutive slashes, <path> doesn't start with a slash and its length doesn't exceed 20.
Addresses are not guaranteed to be distinct.
Output Specification:
First print *k* — the number of groups of server names that correspond to one website. You should count only groups of size greater than one.
Next *k* lines should contain the description of groups, one group per line. For each group print all server names separated by a single space. You are allowed to print both groups and names inside any group in arbitrary order.
Demo Input:
['10\nhttp://abacaba.ru/test\nhttp://abacaba.ru/\nhttp://abacaba.com\nhttp://abacaba.com/test\nhttp://abacaba.de/\nhttp://abacaba.ru/test\nhttp://abacaba.de/test\nhttp://abacaba.com/\nhttp://abacaba.com/t\nhttp://abacaba.com/test\n', '14\nhttp://c\nhttp://ccc.bbbb/aba..b\nhttp://cba.com\nhttp://a.c/aba..b/a\nhttp://abc/\nhttp://a.c/\nhttp://ccc.bbbb\nhttp://ab.ac.bc.aa/\nhttp://a.a.a/\nhttp://ccc.bbbb/\nhttp://cba.com/\nhttp://cba.com/aba..b\nhttp://a.a.a/aba..b/a\nhttp://abc/aba..b/a\n']
Demo Output:
['1\nhttp://abacaba.de http://abacaba.ru \n', '2\nhttp://cba.com http://ccc.bbbb \nhttp://a.a.a http://a.c http://abc \n']
Note:
none | ```python
n = int(input())
w = {}
for g in range(n):
s = input().split('/')
s[2] = 'http://' + s[2]
if not(w.get(s[2])):
w[s[2]] = set(s[3:])
else:
w[s[2]] = w[s[2]].union(s[3:])
bad = set()
for name, s in w.items():
bad.add(name)
for name2, s2 in w.items():
if name2 in bad: continue
if s == s2: print(name, name2)
``` | 0 | |
754 | A | Lesha and array splitting | PROGRAMMING | 1,200 | [
"constructive algorithms",
"greedy",
"implementation"
] | null | null | One spring day on his way to university Lesha found an array *A*. Lesha likes to split arrays into several parts. This time Lesha decided to split the array *A* into several, possibly one, new arrays so that the sum of elements in each of the new arrays is not zero. One more condition is that if we place the new arrays one after another they will form the old array *A*.
Lesha is tired now so he asked you to split the array. Help Lesha! | The first line contains single integer *n* (1<=≤<=*n*<=≤<=100) — the number of elements in the array *A*.
The next line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (<=-<=103<=≤<=*a**i*<=≤<=103) — the elements of the array *A*. | If it is not possible to split the array *A* and satisfy all the constraints, print single line containing "NO" (without quotes).
Otherwise in the first line print "YES" (without quotes). In the next line print single integer *k* — the number of new arrays. In each of the next *k* lines print two integers *l**i* and *r**i* which denote the subarray *A*[*l**i*... *r**i*] of the initial array *A* being the *i*-th new array. Integers *l**i*, *r**i* should satisfy the following conditions:
- *l*1<==<=1 - *r**k*<==<=*n* - *r**i*<=+<=1<==<=*l**i*<=+<=1 for each 1<=≤<=*i*<=<<=*k*.
If there are multiple answers, print any of them. | [
"3\n1 2 -3\n",
"8\n9 -12 3 4 -4 -10 7 3\n",
"1\n0\n",
"4\n1 2 3 -5\n"
] | [
"YES\n2\n1 2\n3 3\n",
"YES\n2\n1 2\n3 8\n",
"NO\n",
"YES\n4\n1 1\n2 2\n3 3\n4 4\n"
] | none | 500 | [
{
"input": "3\n1 2 -3",
"output": "YES\n3\n1 1\n2 2\n3 3"
},
{
"input": "8\n9 -12 3 4 -4 -10 7 3",
"output": "YES\n8\n1 1\n2 2\n3 3\n4 4\n5 5\n6 6\n7 7\n8 8"
},
{
"input": "1\n0",
"output": "NO"
},
{
"input": "4\n1 2 3 -5",
"output": "YES\n4\n1 1\n2 2\n3 3\n4 4"
},
{
... | 1,641,376,331 | 2,147,483,647 | Python 3 | COMPILATION_ERROR | TESTS | 0 | 0 | 0 | a=int(input())
l=list(map(int,input().split()))
i=1
while(i<a) and l[i-1]<l[i]:
i=i+1
while(i<a) and l[i-1]==l[i]:
i=i+1
while(i<a) and l[i-1]>l[i]:
i=i+1
if(i==a):
print("Yes")
else:
print("No")
[03/01, 5:03 pm] +91 99959 59240: a=int(input())
for i in range(a):
n=int(input())
l=list(map(int,input().split()))
h=sorted(l)
m=h[1]
for j in h:
if j!=m:
print(l.index(j)+1) | Title: Lesha and array splitting
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One spring day on his way to university Lesha found an array *A*. Lesha likes to split arrays into several parts. This time Lesha decided to split the array *A* into several, possibly one, new arrays so that the sum of elements in each of the new arrays is not zero. One more condition is that if we place the new arrays one after another they will form the old array *A*.
Lesha is tired now so he asked you to split the array. Help Lesha!
Input Specification:
The first line contains single integer *n* (1<=≤<=*n*<=≤<=100) — the number of elements in the array *A*.
The next line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (<=-<=103<=≤<=*a**i*<=≤<=103) — the elements of the array *A*.
Output Specification:
If it is not possible to split the array *A* and satisfy all the constraints, print single line containing "NO" (without quotes).
Otherwise in the first line print "YES" (without quotes). In the next line print single integer *k* — the number of new arrays. In each of the next *k* lines print two integers *l**i* and *r**i* which denote the subarray *A*[*l**i*... *r**i*] of the initial array *A* being the *i*-th new array. Integers *l**i*, *r**i* should satisfy the following conditions:
- *l*1<==<=1 - *r**k*<==<=*n* - *r**i*<=+<=1<==<=*l**i*<=+<=1 for each 1<=≤<=*i*<=<<=*k*.
If there are multiple answers, print any of them.
Demo Input:
['3\n1 2 -3\n', '8\n9 -12 3 4 -4 -10 7 3\n', '1\n0\n', '4\n1 2 3 -5\n']
Demo Output:
['YES\n2\n1 2\n3 3\n', 'YES\n2\n1 2\n3 8\n', 'NO\n', 'YES\n4\n1 1\n2 2\n3 3\n4 4\n']
Note:
none | ```python
a=int(input())
l=list(map(int,input().split()))
i=1
while(i<a) and l[i-1]<l[i]:
i=i+1
while(i<a) and l[i-1]==l[i]:
i=i+1
while(i<a) and l[i-1]>l[i]:
i=i+1
if(i==a):
print("Yes")
else:
print("No")
[03/01, 5:03 pm] +91 99959 59240: a=int(input())
for i in range(a):
n=int(input())
l=list(map(int,input().split()))
h=sorted(l)
m=h[1]
for j in h:
if j!=m:
print(l.index(j)+1)
``` | -1 | |
41 | A | Translation | PROGRAMMING | 800 | [
"implementation",
"strings"
] | A. Translation | 2 | 256 | The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly. | The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols. | If the word *t* is a word *s*, written reversely, print YES, otherwise print NO. | [
"code\nedoc\n",
"abb\naba\n",
"code\ncode\n"
] | [
"YES\n",
"NO\n",
"NO\n"
] | none | 500 | [
{
"input": "code\nedoc",
"output": "YES"
},
{
"input": "abb\naba",
"output": "NO"
},
{
"input": "code\ncode",
"output": "NO"
},
{
"input": "abacaba\nabacaba",
"output": "YES"
},
{
"input": "q\nq",
"output": "YES"
},
{
"input": "asrgdfngfnmfgnhweratgjkk... | 1,694,612,742 | 2,147,483,647 | Python 3 | OK | TESTS | 40 | 92 | 0 | A=input()
B=input()
A1=A[::-1]
if A1==B:
print("YES")
else:
print("NO") | Title: Translation
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly.
Input Specification:
The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols.
Output Specification:
If the word *t* is a word *s*, written reversely, print YES, otherwise print NO.
Demo Input:
['code\nedoc\n', 'abb\naba\n', 'code\ncode\n']
Demo Output:
['YES\n', 'NO\n', 'NO\n']
Note:
none | ```python
A=input()
B=input()
A1=A[::-1]
if A1==B:
print("YES")
else:
print("NO")
``` | 3.977 |
472 | A | Design Tutorial: Learn from Math | PROGRAMMING | 800 | [
"math",
"number theory"
] | null | null | One way to create a task is to learn from math. You can generate some random math statement or modify some theorems to get something new and build a new task from that.
For example, there is a statement called the "Goldbach's conjecture". It says: "each even number no less than four can be expressed as the sum of two primes". Let's modify it. How about a statement like that: "each integer no less than 12 can be expressed as the sum of two composite numbers." Not like the Goldbach's conjecture, I can prove this theorem.
You are given an integer *n* no less than 12, express it as a sum of two composite numbers. | The only line contains an integer *n* (12<=≤<=*n*<=≤<=106). | Output two composite integers *x* and *y* (1<=<<=*x*,<=*y*<=<<=*n*) such that *x*<=+<=*y*<==<=*n*. If there are multiple solutions, you can output any of them. | [
"12\n",
"15\n",
"23\n",
"1000000\n"
] | [
"4 8\n",
"6 9\n",
"8 15\n",
"500000 500000\n"
] | In the first example, 12 = 4 + 8 and both 4, 8 are composite numbers. You can output "6 6" or "8 4" as well.
In the second example, 15 = 6 + 9. Note that you can't output "1 14" because 1 is not a composite number. | 500 | [
{
"input": "12",
"output": "4 8"
},
{
"input": "15",
"output": "6 9"
},
{
"input": "23",
"output": "8 15"
},
{
"input": "1000000",
"output": "500000 500000"
},
{
"input": "63874",
"output": "4 63870"
},
{
"input": "14568",
"output": "4 14564"
},
... | 1,682,129,981 | 2,147,483,647 | Python 3 | OK | TESTS | 33 | 108 | 0 | def prime(n):
for i in range(2,n//2+1):
if n%i==0:
return False
return True
n=int(input())
for i in range(2,n):
if prime(i)==False and prime(n-i)==False:
print(i,n-i)
break | Title: Design Tutorial: Learn from Math
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One way to create a task is to learn from math. You can generate some random math statement or modify some theorems to get something new and build a new task from that.
For example, there is a statement called the "Goldbach's conjecture". It says: "each even number no less than four can be expressed as the sum of two primes". Let's modify it. How about a statement like that: "each integer no less than 12 can be expressed as the sum of two composite numbers." Not like the Goldbach's conjecture, I can prove this theorem.
You are given an integer *n* no less than 12, express it as a sum of two composite numbers.
Input Specification:
The only line contains an integer *n* (12<=≤<=*n*<=≤<=106).
Output Specification:
Output two composite integers *x* and *y* (1<=<<=*x*,<=*y*<=<<=*n*) such that *x*<=+<=*y*<==<=*n*. If there are multiple solutions, you can output any of them.
Demo Input:
['12\n', '15\n', '23\n', '1000000\n']
Demo Output:
['4 8\n', '6 9\n', '8 15\n', '500000 500000\n']
Note:
In the first example, 12 = 4 + 8 and both 4, 8 are composite numbers. You can output "6 6" or "8 4" as well.
In the second example, 15 = 6 + 9. Note that you can't output "1 14" because 1 is not a composite number. | ```python
def prime(n):
for i in range(2,n//2+1):
if n%i==0:
return False
return True
n=int(input())
for i in range(2,n):
if prime(i)==False and prime(n-i)==False:
print(i,n-i)
break
``` | 3 | |
11 | A | Increasing Sequence | PROGRAMMING | 900 | [
"constructive algorithms",
"implementation",
"math"
] | A. Increasing Sequence | 1 | 64 | A sequence *a*0,<=*a*1,<=...,<=*a**t*<=-<=1 is called increasing if *a**i*<=-<=1<=<<=*a**i* for each *i*:<=0<=<<=*i*<=<<=*t*.
You are given a sequence *b*0,<=*b*1,<=...,<=*b**n*<=-<=1 and a positive integer *d*. In each move you may choose one element of the given sequence and add *d* to it. What is the least number of moves required to make the given sequence increasing? | The first line of the input contains two integer numbers *n* and *d* (2<=≤<=*n*<=≤<=2000,<=1<=≤<=*d*<=≤<=106). The second line contains space separated sequence *b*0,<=*b*1,<=...,<=*b**n*<=-<=1 (1<=≤<=*b**i*<=≤<=106). | Output the minimal number of moves needed to make the sequence increasing. | [
"4 2\n1 3 3 2\n"
] | [
"3\n"
] | none | 0 | [
{
"input": "4 2\n1 3 3 2",
"output": "3"
},
{
"input": "2 1\n1 1",
"output": "1"
},
{
"input": "2 1\n2 5",
"output": "0"
},
{
"input": "2 1\n1 2",
"output": "0"
},
{
"input": "2 1\n1 1",
"output": "1"
},
{
"input": "2 7\n10 20",
"output": "0"
},
... | 1,686,529,140 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 2 | 62 | 0 | n,d=map(int,input().split())
a=list(map(int,input().split()))
l=0
for i in range(1,len(a)):
k = 0
k = (a[i-1]-a[i]//d)+1
print(k)
| Title: Increasing Sequence
Time Limit: 1 seconds
Memory Limit: 64 megabytes
Problem Description:
A sequence *a*0,<=*a*1,<=...,<=*a**t*<=-<=1 is called increasing if *a**i*<=-<=1<=<<=*a**i* for each *i*:<=0<=<<=*i*<=<<=*t*.
You are given a sequence *b*0,<=*b*1,<=...,<=*b**n*<=-<=1 and a positive integer *d*. In each move you may choose one element of the given sequence and add *d* to it. What is the least number of moves required to make the given sequence increasing?
Input Specification:
The first line of the input contains two integer numbers *n* and *d* (2<=≤<=*n*<=≤<=2000,<=1<=≤<=*d*<=≤<=106). The second line contains space separated sequence *b*0,<=*b*1,<=...,<=*b**n*<=-<=1 (1<=≤<=*b**i*<=≤<=106).
Output Specification:
Output the minimal number of moves needed to make the sequence increasing.
Demo Input:
['4 2\n1 3 3 2\n']
Demo Output:
['3\n']
Note:
none | ```python
n,d=map(int,input().split())
a=list(map(int,input().split()))
l=0
for i in range(1,len(a)):
k = 0
k = (a[i-1]-a[i]//d)+1
print(k)
``` | 0 |
102 | B | Sum of Digits | PROGRAMMING | 1,000 | [
"implementation"
] | B. Sum of Digits | 2 | 265 | Having watched the last Harry Potter film, little Gerald also decided to practice magic. He found in his father's magical book a spell that turns any number in the sum of its digits. At the moment Gerald learned that, he came across a number *n*. How many times can Gerald put a spell on it until the number becomes one-digit? | The first line contains the only integer *n* (0<=≤<=*n*<=≤<=10100000). It is guaranteed that *n* doesn't contain any leading zeroes. | Print the number of times a number can be replaced by the sum of its digits until it only contains one digit. | [
"0\n",
"10\n",
"991\n"
] | [
"0\n",
"1\n",
"3\n"
] | In the first sample the number already is one-digit — Herald can't cast a spell.
The second test contains number 10. After one casting of a spell it becomes 1, and here the process is completed. Thus, Gerald can only cast the spell once.
The third test contains number 991. As one casts a spell the following transformations take place: 991 → 19 → 10 → 1. After three transformations the number becomes one-digit. | 1,000 | [
{
"input": "0",
"output": "0"
},
{
"input": "10",
"output": "1"
},
{
"input": "991",
"output": "3"
},
{
"input": "99",
"output": "2"
},
{
"input": "100",
"output": "1"
},
{
"input": "123456789",
"output": "2"
},
{
"input": "32",
"output... | 1,684,846,087 | 2,147,483,647 | PyPy 3-64 | WRONG_ANSWER | TESTS | 0 | 92 | 0 | def digital_root(n):
if n < 10:
return 0
sum_digits = sum(int(digit) for digit in str(n))
return 1 + digital_root(sum_digits)
| Title: Sum of Digits
Time Limit: 2 seconds
Memory Limit: 265 megabytes
Problem Description:
Having watched the last Harry Potter film, little Gerald also decided to practice magic. He found in his father's magical book a spell that turns any number in the sum of its digits. At the moment Gerald learned that, he came across a number *n*. How many times can Gerald put a spell on it until the number becomes one-digit?
Input Specification:
The first line contains the only integer *n* (0<=≤<=*n*<=≤<=10100000). It is guaranteed that *n* doesn't contain any leading zeroes.
Output Specification:
Print the number of times a number can be replaced by the sum of its digits until it only contains one digit.
Demo Input:
['0\n', '10\n', '991\n']
Demo Output:
['0\n', '1\n', '3\n']
Note:
In the first sample the number already is one-digit — Herald can't cast a spell.
The second test contains number 10. After one casting of a spell it becomes 1, and here the process is completed. Thus, Gerald can only cast the spell once.
The third test contains number 991. As one casts a spell the following transformations take place: 991 → 19 → 10 → 1. After three transformations the number becomes one-digit. | ```python
def digital_root(n):
if n < 10:
return 0
sum_digits = sum(int(digit) for digit in str(n))
return 1 + digital_root(sum_digits)
``` | 0 |
109 | B | Lucky Probability | PROGRAMMING | 1,900 | [
"brute force",
"probabilities"
] | B. Lucky Probability | 2 | 256 | Petya loves lucky numbers. We all know that lucky numbers are the positive integers whose decimal representations contain only the lucky digits 4 and 7. For example, numbers 47, 744, 4 are lucky and 5, 17, 467 are not.
Petya and his friend Vasya play an interesting game. Petya randomly chooses an integer *p* from the interval [*p**l*,<=*p**r*] and Vasya chooses an integer *v* from the interval [*v**l*,<=*v**r*] (also randomly). Both players choose their integers equiprobably. Find the probability that the interval [*min*(*v*,<=*p*),<=*max*(*v*,<=*p*)] contains exactly *k* lucky numbers. | The single line contains five integers *p**l*, *p**r*, *v**l*, *v**r* and *k* (1<=≤<=*p**l*<=≤<=*p**r*<=≤<=109,<=1<=≤<=*v**l*<=≤<=*v**r*<=≤<=109,<=1<=≤<=*k*<=≤<=1000). | On the single line print the result with an absolute error of no more than 10<=-<=9. | [
"1 10 1 10 2\n",
"5 6 8 10 1\n"
] | [
"0.320000000000\n",
"1.000000000000\n"
] | Consider that [*a*, *b*] denotes an interval of integers; this interval includes the boundaries. That is, <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/18b4a6012d95ad18891561410f0314497a578d63.png" style="max-width: 100.0%;max-height: 100.0%;"/>
In first case there are 32 suitable pairs: (1, 7), (1, 8), (1, 9), (1, 10), (2, 7), (2, 8), (2, 9), (2, 10), (3, 7), (3, 8), (3, 9), (3, 10), (4, 7), (4, 8), (4, 9), (4, 10), (7, 1), (7, 2), (7, 3), (7, 4), (8, 1), (8, 2), (8, 3), (8, 4), (9, 1), (9, 2), (9, 3), (9, 4), (10, 1), (10, 2), (10, 3), (10, 4). Total number of possible pairs is 10·10 = 100, so answer is 32 / 100.
In second case Petya always get number less than Vasya and the only lucky 7 is between this numbers, so there will be always 1 lucky number. | 1,000 | [
{
"input": "1 10 1 10 2",
"output": "0.320000000000"
},
{
"input": "5 6 8 10 1",
"output": "1.000000000000"
},
{
"input": "1 20 100 120 5",
"output": "0.150000000000"
},
{
"input": "1 10 1 10 3",
"output": "0.000000000000"
},
{
"input": "1 100 1 100 2",
"outpu... | 1,697,994,485 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 2 | 62 | 102,400 | def main():
inp = input().split()
p1, p2, v1, v2, k = map(int, inp)
probability = 0
# +1 потому что скобки квадратные, мы включаем границы
all_possible_exoduses = (p2 - p1 + 1) * (v2 - v1 + 1)
all_k_lucky_combinations = score_all_k_lucky_combinations(
k, find_all_lucky_numbers(p1, p2, v1, v2))
for combination in all_k_lucky_combinations:
probability += find_probability_for_one_combination(combination, p1, p2, v1, v2, k)
print(probability)
def find_all_lucky_numbers(p1, p2, v1, v2):
max_x = max(p2, v2)
min_x = min(p1, v1)
all_possible_lucky_numbers_in_segment = []
for i in range(min_x, max_x):
if is_only_4s_and_7s(i):
all_possible_lucky_numbers_in_segment.append(i)
return all_possible_lucky_numbers_in_segment
def score_all_k_lucky_combinations(
k, all_possible_lucky_numbers_in_segment):
all_k_lucky_combinations = []
for i in range(len(all_possible_lucky_numbers_in_segment)):
if len(all_possible_lucky_numbers_in_segment[i:k + i]) == k:
all_k_lucky_combinations.append(
all_possible_lucky_numbers_in_segment[i:k + i])
return all_k_lucky_combinations
def find_probability_for_one_combination(combination, p1, p2, v1, v2, k):
left_elem = combination[0]
right_elem = combination[k - 1]
v_len = v2 - v1 + 1
p_len = p2 - p1 + 1
v1_to_left = left_elem - v1 + 1
p1_to_left = left_elem - p1 + 1
v2_to_right = v2 - right_elem + 1
p2_to_right = p2 - right_elem + 1
v1_probability = 0
p1_probability = 0
v2_probability = 0
p2_probability = 0
if v1_to_left > 0:
v1_probability = v1_to_left / v_len
if p1_to_left > 0:
p1_probability = p1_to_left / p_len
if v2_to_right > 0:
v2_probability = v2_to_right / v_len
if p2_to_right > 0:
p2_probability = p2_to_right / p_len
if right_elem <= v1 and right_elem <= v2:
v1_probability = 1
v2_probability = 1
if right_elem <= p1 and right_elem <= p2:
p1_probability = 1
p2_probability = 1
if left_elem >= v1 and left_elem >= v2:
v1_probability = 1
v2_probability = 1
if left_elem >= p1 and left_elem >= p2:
p1_probability = 1
p2_probability = 1
if v1_probability * p2_probability and v2_probability * p1_probability == 1:
return 1
if v1_probability * p2_probability == 1:
v1_probability = 0
p2_probability = 0
if v2_probability * p1_probability == 1:
v2_probability = 0
p1_probability = 0
probability = (v1_probability * p2_probability) \
+ (v2_probability * p1_probability)
return probability
def is_only_4s_and_7s(number):
for digit in str(number):
if digit not in ['4', '7']:
return False
return True
if __name__ == "__main__":
main()
| Title: Lucky Probability
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Petya loves lucky numbers. We all know that lucky numbers are the positive integers whose decimal representations contain only the lucky digits 4 and 7. For example, numbers 47, 744, 4 are lucky and 5, 17, 467 are not.
Petya and his friend Vasya play an interesting game. Petya randomly chooses an integer *p* from the interval [*p**l*,<=*p**r*] and Vasya chooses an integer *v* from the interval [*v**l*,<=*v**r*] (also randomly). Both players choose their integers equiprobably. Find the probability that the interval [*min*(*v*,<=*p*),<=*max*(*v*,<=*p*)] contains exactly *k* lucky numbers.
Input Specification:
The single line contains five integers *p**l*, *p**r*, *v**l*, *v**r* and *k* (1<=≤<=*p**l*<=≤<=*p**r*<=≤<=109,<=1<=≤<=*v**l*<=≤<=*v**r*<=≤<=109,<=1<=≤<=*k*<=≤<=1000).
Output Specification:
On the single line print the result with an absolute error of no more than 10<=-<=9.
Demo Input:
['1 10 1 10 2\n', '5 6 8 10 1\n']
Demo Output:
['0.320000000000\n', '1.000000000000\n']
Note:
Consider that [*a*, *b*] denotes an interval of integers; this interval includes the boundaries. That is, <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/18b4a6012d95ad18891561410f0314497a578d63.png" style="max-width: 100.0%;max-height: 100.0%;"/>
In first case there are 32 suitable pairs: (1, 7), (1, 8), (1, 9), (1, 10), (2, 7), (2, 8), (2, 9), (2, 10), (3, 7), (3, 8), (3, 9), (3, 10), (4, 7), (4, 8), (4, 9), (4, 10), (7, 1), (7, 2), (7, 3), (7, 4), (8, 1), (8, 2), (8, 3), (8, 4), (9, 1), (9, 2), (9, 3), (9, 4), (10, 1), (10, 2), (10, 3), (10, 4). Total number of possible pairs is 10·10 = 100, so answer is 32 / 100.
In second case Petya always get number less than Vasya and the only lucky 7 is between this numbers, so there will be always 1 lucky number. | ```python
def main():
inp = input().split()
p1, p2, v1, v2, k = map(int, inp)
probability = 0
# +1 потому что скобки квадратные, мы включаем границы
all_possible_exoduses = (p2 - p1 + 1) * (v2 - v1 + 1)
all_k_lucky_combinations = score_all_k_lucky_combinations(
k, find_all_lucky_numbers(p1, p2, v1, v2))
for combination in all_k_lucky_combinations:
probability += find_probability_for_one_combination(combination, p1, p2, v1, v2, k)
print(probability)
def find_all_lucky_numbers(p1, p2, v1, v2):
max_x = max(p2, v2)
min_x = min(p1, v1)
all_possible_lucky_numbers_in_segment = []
for i in range(min_x, max_x):
if is_only_4s_and_7s(i):
all_possible_lucky_numbers_in_segment.append(i)
return all_possible_lucky_numbers_in_segment
def score_all_k_lucky_combinations(
k, all_possible_lucky_numbers_in_segment):
all_k_lucky_combinations = []
for i in range(len(all_possible_lucky_numbers_in_segment)):
if len(all_possible_lucky_numbers_in_segment[i:k + i]) == k:
all_k_lucky_combinations.append(
all_possible_lucky_numbers_in_segment[i:k + i])
return all_k_lucky_combinations
def find_probability_for_one_combination(combination, p1, p2, v1, v2, k):
left_elem = combination[0]
right_elem = combination[k - 1]
v_len = v2 - v1 + 1
p_len = p2 - p1 + 1
v1_to_left = left_elem - v1 + 1
p1_to_left = left_elem - p1 + 1
v2_to_right = v2 - right_elem + 1
p2_to_right = p2 - right_elem + 1
v1_probability = 0
p1_probability = 0
v2_probability = 0
p2_probability = 0
if v1_to_left > 0:
v1_probability = v1_to_left / v_len
if p1_to_left > 0:
p1_probability = p1_to_left / p_len
if v2_to_right > 0:
v2_probability = v2_to_right / v_len
if p2_to_right > 0:
p2_probability = p2_to_right / p_len
if right_elem <= v1 and right_elem <= v2:
v1_probability = 1
v2_probability = 1
if right_elem <= p1 and right_elem <= p2:
p1_probability = 1
p2_probability = 1
if left_elem >= v1 and left_elem >= v2:
v1_probability = 1
v2_probability = 1
if left_elem >= p1 and left_elem >= p2:
p1_probability = 1
p2_probability = 1
if v1_probability * p2_probability and v2_probability * p1_probability == 1:
return 1
if v1_probability * p2_probability == 1:
v1_probability = 0
p2_probability = 0
if v2_probability * p1_probability == 1:
v2_probability = 0
p1_probability = 0
probability = (v1_probability * p2_probability) \
+ (v2_probability * p1_probability)
return probability
def is_only_4s_and_7s(number):
for digit in str(number):
if digit not in ['4', '7']:
return False
return True
if __name__ == "__main__":
main()
``` | 0 |
253 | C | Text Editor | PROGRAMMING | 1,600 | [
"data structures",
"dfs and similar",
"graphs",
"greedy",
"shortest paths"
] | null | null | Vasya is pressing the keys on the keyboard reluctantly, squeezing out his ideas on the classical epos depicted in Homer's Odysseus... How can he explain to his literature teacher that he isn't going to become a writer? In fact, he is going to become a programmer. So, he would take great pleasure in writing a program, but none — in writing a composition.
As Vasya was fishing for a sentence in the dark pond of his imagination, he suddenly wondered: what is the least number of times he should push a key to shift the cursor from one position to another one?
Let's describe his question more formally: to type a text, Vasya is using the text editor. He has already written *n* lines, the *i*-th line contains *a**i* characters (including spaces). If some line contains *k* characters, then this line overall contains (*k*<=+<=1) positions where the cursor can stand: before some character or after all characters (at the end of the line). Thus, the cursor's position is determined by a pair of integers (*r*,<=*c*), where *r* is the number of the line and *c* is the cursor's position in the line (the positions are indexed starting from one from the beginning of the line).
Vasya doesn't use the mouse to move the cursor. He uses keys "Up", "Down", "Right" and "Left". When he pushes each of these keys, the cursor shifts in the needed direction. Let's assume that before the corresponding key is pressed, the cursor was located in the position (*r*,<=*c*), then Vasya pushed key:
- "Up": if the cursor was located in the first line (*r*<==<=1), then it does not move. Otherwise, it moves to the previous line (with number *r*<=-<=1), to the same position. At that, if the previous line was short, that is, the cursor couldn't occupy position *c* there, the cursor moves to the last position of the line with number *r*<=-<=1;- "Down": if the cursor was located in the last line (*r*<==<=*n*), then it does not move. Otherwise, it moves to the next line (with number *r*<=+<=1), to the same position. At that, if the next line was short, that is, the cursor couldn't occupy position *c* there, the cursor moves to the last position of the line with number *r*<=+<=1;- "Right": if the cursor can move to the right in this line (*c*<=<<=*a**r*<=+<=1), then it moves to the right (to position *c*<=+<=1). Otherwise, it is located at the end of the line and doesn't move anywhere when Vasya presses the "Right" key;- "Left": if the cursor can move to the left in this line (*c*<=><=1), then it moves to the left (to position *c*<=-<=1). Otherwise, it is located at the beginning of the line and doesn't move anywhere when Vasya presses the "Left" key.
You've got the number of lines in the text file and the number of characters, written in each line of this file. Find the least number of times Vasya should push the keys, described above, to shift the cursor from position (*r*1,<=*c*1) to position (*r*2,<=*c*2). | The first line of the input contains an integer *n* (1<=≤<=*n*<=≤<=100) — the number of lines in the file. The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=105), separated by single spaces. The third line contains four integers *r*1,<=*c*1,<=*r*2,<=*c*2 (1<=≤<=*r*1,<=*r*2<=≤<=*n*,<=1<=≤<=*c*1<=≤<=*a**r*1<=+<=1,<=1<=≤<=*c*2<=≤<=*a**r*2<=+<=1). | Print a single integer — the minimum number of times Vasya should push a key to move the cursor from position (*r*1,<=*c*1) to position (*r*2,<=*c*2). | [
"4\n2 1 6 4\n3 4 4 2\n",
"4\n10 5 6 4\n1 11 4 2\n",
"3\n10 1 10\n1 10 1 1\n"
] | [
"3\n",
"6\n",
"3\n"
] | In the first sample the editor contains four lines. Let's represent the cursor's possible positions in the line as numbers. Letter *s* represents the cursor's initial position, letter *t* represents the last one. Then all possible positions of the cursor in the text editor are described by the following table.
123
12
123s567
1t345
One of the possible answers in the given sample is: "Left", "Down", "Left". | 1,500 | [
{
"input": "4\n2 1 6 4\n3 4 4 2",
"output": "3"
},
{
"input": "4\n10 5 6 4\n1 11 4 2",
"output": "6"
},
{
"input": "3\n10 1 10\n1 10 1 1",
"output": "3"
},
{
"input": "4\n2 1 6 4\n4 2 3 5",
"output": "4"
},
{
"input": "3\n20 3 20\n1 20 1 1",
"output": "5"
},... | 1,620,644,227 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 92 | 6,963,200 | class Solution_once:
def singleNumber(self, arr):
ones, twos = 0, 0
for x in arr:
ones, twos = (ones ^ x) & ~twos, (ones & x) | (twos & ~x)
assert twos == 0
return ones
class Solution_twice:
def single_number(arr):
ones, twos, threes = 0, 0, 0
for x in arr:
ones, twos, threes = (~x & ones) | (x & ~ones & ~twos & ~threes), (~x & twos) | (x & ones), (~x & threes) | (x & twos)
return twos
if __name__ == "__main__":
print(Solution_once().singleNumber([1, 1, 1, 2, 2, 2, 3]))
print(Solution_once().singleNumber([5, 3, 0, 3, 5, 5, 3]))
| Title: Text Editor
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya is pressing the keys on the keyboard reluctantly, squeezing out his ideas on the classical epos depicted in Homer's Odysseus... How can he explain to his literature teacher that he isn't going to become a writer? In fact, he is going to become a programmer. So, he would take great pleasure in writing a program, but none — in writing a composition.
As Vasya was fishing for a sentence in the dark pond of his imagination, he suddenly wondered: what is the least number of times he should push a key to shift the cursor from one position to another one?
Let's describe his question more formally: to type a text, Vasya is using the text editor. He has already written *n* lines, the *i*-th line contains *a**i* characters (including spaces). If some line contains *k* characters, then this line overall contains (*k*<=+<=1) positions where the cursor can stand: before some character or after all characters (at the end of the line). Thus, the cursor's position is determined by a pair of integers (*r*,<=*c*), where *r* is the number of the line and *c* is the cursor's position in the line (the positions are indexed starting from one from the beginning of the line).
Vasya doesn't use the mouse to move the cursor. He uses keys "Up", "Down", "Right" and "Left". When he pushes each of these keys, the cursor shifts in the needed direction. Let's assume that before the corresponding key is pressed, the cursor was located in the position (*r*,<=*c*), then Vasya pushed key:
- "Up": if the cursor was located in the first line (*r*<==<=1), then it does not move. Otherwise, it moves to the previous line (with number *r*<=-<=1), to the same position. At that, if the previous line was short, that is, the cursor couldn't occupy position *c* there, the cursor moves to the last position of the line with number *r*<=-<=1;- "Down": if the cursor was located in the last line (*r*<==<=*n*), then it does not move. Otherwise, it moves to the next line (with number *r*<=+<=1), to the same position. At that, if the next line was short, that is, the cursor couldn't occupy position *c* there, the cursor moves to the last position of the line with number *r*<=+<=1;- "Right": if the cursor can move to the right in this line (*c*<=<<=*a**r*<=+<=1), then it moves to the right (to position *c*<=+<=1). Otherwise, it is located at the end of the line and doesn't move anywhere when Vasya presses the "Right" key;- "Left": if the cursor can move to the left in this line (*c*<=><=1), then it moves to the left (to position *c*<=-<=1). Otherwise, it is located at the beginning of the line and doesn't move anywhere when Vasya presses the "Left" key.
You've got the number of lines in the text file and the number of characters, written in each line of this file. Find the least number of times Vasya should push the keys, described above, to shift the cursor from position (*r*1,<=*c*1) to position (*r*2,<=*c*2).
Input Specification:
The first line of the input contains an integer *n* (1<=≤<=*n*<=≤<=100) — the number of lines in the file. The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=105), separated by single spaces. The third line contains four integers *r*1,<=*c*1,<=*r*2,<=*c*2 (1<=≤<=*r*1,<=*r*2<=≤<=*n*,<=1<=≤<=*c*1<=≤<=*a**r*1<=+<=1,<=1<=≤<=*c*2<=≤<=*a**r*2<=+<=1).
Output Specification:
Print a single integer — the minimum number of times Vasya should push a key to move the cursor from position (*r*1,<=*c*1) to position (*r*2,<=*c*2).
Demo Input:
['4\n2 1 6 4\n3 4 4 2\n', '4\n10 5 6 4\n1 11 4 2\n', '3\n10 1 10\n1 10 1 1\n']
Demo Output:
['3\n', '6\n', '3\n']
Note:
In the first sample the editor contains four lines. Let's represent the cursor's possible positions in the line as numbers. Letter *s* represents the cursor's initial position, letter *t* represents the last one. Then all possible positions of the cursor in the text editor are described by the following table.
123
12
123s567
1t345
One of the possible answers in the given sample is: "Left", "Down", "Left". | ```python
class Solution_once:
def singleNumber(self, arr):
ones, twos = 0, 0
for x in arr:
ones, twos = (ones ^ x) & ~twos, (ones & x) | (twos & ~x)
assert twos == 0
return ones
class Solution_twice:
def single_number(arr):
ones, twos, threes = 0, 0, 0
for x in arr:
ones, twos, threes = (~x & ones) | (x & ~ones & ~twos & ~threes), (~x & twos) | (x & ones), (~x & threes) | (x & twos)
return twos
if __name__ == "__main__":
print(Solution_once().singleNumber([1, 1, 1, 2, 2, 2, 3]))
print(Solution_once().singleNumber([5, 3, 0, 3, 5, 5, 3]))
``` | 0 | |
80 | A | Panoramix's Prediction | PROGRAMMING | 800 | [
"brute force"
] | A. Panoramix's Prediction | 2 | 256 | A prime number is a number which has exactly two distinct divisors: one and itself. For example, numbers 2, 7, 3 are prime, and 1, 6, 4 are not.
The next prime number after *x* is the smallest prime number greater than *x*. For example, the next prime number after 2 is 3, and the next prime number after 3 is 5. Note that there is exactly one next prime number after each number. So 5 is not the next prime number for 2.
One cold April morning Panoramix predicted that soon Kakofonix will break free from his straitjacket, and this will be a black day for the residents of the Gallic countryside.
Panoramix's prophecy tells that if some day Asterix and Obelix beat exactly *x* Roman soldiers, where *x* is a prime number, and next day they beat exactly *y* Roman soldiers, where *y* is the next prime number after *x*, then it's time to wait for Armageddon, for nothing can shut Kakofonix up while he sings his infernal song.
Yesterday the Gauls beat *n* Roman soldiers and it turned out that the number *n* was prime! Today their victims were a troop of *m* Romans (*m*<=><=*n*). Determine whether the Gauls should wait for the black day after today's victory of Asterix and Obelix? | The first and only input line contains two positive integers — *n* and *m* (2<=≤<=*n*<=<<=*m*<=≤<=50). It is guaranteed that *n* is prime.
Pretests contain all the cases with restrictions 2<=≤<=*n*<=<<=*m*<=≤<=4. | Print YES, if *m* is the next prime number after *n*, or NO otherwise. | [
"3 5\n",
"7 11\n",
"7 9\n"
] | [
"YES",
"YES",
"NO"
] | none | 500 | [
{
"input": "3 5",
"output": "YES"
},
{
"input": "7 11",
"output": "YES"
},
{
"input": "7 9",
"output": "NO"
},
{
"input": "2 3",
"output": "YES"
},
{
"input": "2 4",
"output": "NO"
},
{
"input": "3 4",
"output": "NO"
},
{
"input": "3 5",
... | 1,675,415,536 | 2,147,483,647 | PyPy 3 | RUNTIME_ERROR | TESTS | 39 | 186 | 2,150,400 | primes = [2, 3, 5, 7, 11, 13, 17, 19, 23, 29, 31, 37, 41, 43, 47]
n, m = map(int, input().split())
print("YES") if primes[primes.index(n) + 1] == m else print("NO")
| Title: Panoramix's Prediction
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
A prime number is a number which has exactly two distinct divisors: one and itself. For example, numbers 2, 7, 3 are prime, and 1, 6, 4 are not.
The next prime number after *x* is the smallest prime number greater than *x*. For example, the next prime number after 2 is 3, and the next prime number after 3 is 5. Note that there is exactly one next prime number after each number. So 5 is not the next prime number for 2.
One cold April morning Panoramix predicted that soon Kakofonix will break free from his straitjacket, and this will be a black day for the residents of the Gallic countryside.
Panoramix's prophecy tells that if some day Asterix and Obelix beat exactly *x* Roman soldiers, where *x* is a prime number, and next day they beat exactly *y* Roman soldiers, where *y* is the next prime number after *x*, then it's time to wait for Armageddon, for nothing can shut Kakofonix up while he sings his infernal song.
Yesterday the Gauls beat *n* Roman soldiers and it turned out that the number *n* was prime! Today their victims were a troop of *m* Romans (*m*<=><=*n*). Determine whether the Gauls should wait for the black day after today's victory of Asterix and Obelix?
Input Specification:
The first and only input line contains two positive integers — *n* and *m* (2<=≤<=*n*<=<<=*m*<=≤<=50). It is guaranteed that *n* is prime.
Pretests contain all the cases with restrictions 2<=≤<=*n*<=<<=*m*<=≤<=4.
Output Specification:
Print YES, if *m* is the next prime number after *n*, or NO otherwise.
Demo Input:
['3 5\n', '7 11\n', '7 9\n']
Demo Output:
['YES', 'YES', 'NO']
Note:
none | ```python
primes = [2, 3, 5, 7, 11, 13, 17, 19, 23, 29, 31, 37, 41, 43, 47]
n, m = map(int, input().split())
print("YES") if primes[primes.index(n) + 1] == m else print("NO")
``` | -1 |
0 | none | none | none | 0 | [
"none"
] | null | null | Vasya has *n* days of vacations! So he decided to improve his IT skills and do sport. Vasya knows the following information about each of this *n* days: whether that gym opened and whether a contest was carried out in the Internet on that day. For the *i*-th day there are four options:
1. on this day the gym is closed and the contest is not carried out; 1. on this day the gym is closed and the contest is carried out; 1. on this day the gym is open and the contest is not carried out; 1. on this day the gym is open and the contest is carried out.
On each of days Vasya can either have a rest or write the contest (if it is carried out on this day), or do sport (if the gym is open on this day).
Find the minimum number of days on which Vasya will have a rest (it means, he will not do sport and write the contest at the same time). The only limitation that Vasya has — he does not want to do the same activity on two consecutive days: it means, he will not do sport on two consecutive days, and write the contest on two consecutive days. | The first line contains a positive integer *n* (1<=≤<=*n*<=≤<=100) — the number of days of Vasya's vacations.
The second line contains the sequence of integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=3) separated by space, where:
- *a**i* equals 0, if on the *i*-th day of vacations the gym is closed and the contest is not carried out; - *a**i* equals 1, if on the *i*-th day of vacations the gym is closed, but the contest is carried out; - *a**i* equals 2, if on the *i*-th day of vacations the gym is open and the contest is not carried out; - *a**i* equals 3, if on the *i*-th day of vacations the gym is open and the contest is carried out. | Print the minimum possible number of days on which Vasya will have a rest. Remember that Vasya refuses:
- to do sport on any two consecutive days, - to write the contest on any two consecutive days. | [
"4\n1 3 2 0\n",
"7\n1 3 3 2 1 2 3\n",
"2\n2 2\n"
] | [
"2\n",
"0\n",
"1\n"
] | In the first test Vasya can write the contest on the day number 1 and do sport on the day number 3. Thus, he will have a rest for only 2 days.
In the second test Vasya should write contests on days number 1, 3, 5 and 7, in other days do sport. Thus, he will not have a rest for a single day.
In the third test Vasya can do sport either on a day number 1 or number 2. He can not do sport in two days, because it will be contrary to the his limitation. Thus, he will have a rest for only one day. | 0 | [
{
"input": "4\n1 3 2 0",
"output": "2"
},
{
"input": "7\n1 3 3 2 1 2 3",
"output": "0"
},
{
"input": "2\n2 2",
"output": "1"
},
{
"input": "1\n0",
"output": "1"
},
{
"input": "10\n0 0 1 1 0 0 0 0 1 0",
"output": "8"
},
{
"input": "100\n3 2 3 3 3 2 3 1 ... | 1,468,938,650 | 5,150 | Python 3 | WRONG_ANSWER | PRETESTS | 5 | 77 | 307,200 | from sys import stdin
def remplir(inf,sup,val):
global programme
for i in range(inf,sup+1):
programme[i]=val
val=(val+1)%2
n=int(input())+2
programme=list(map(int,stdin.readline().split()))
programme=[0]+programme
programme.append(0)
chaines=[]
antagoniste=[0,2,1,3]
i=0
while i<n:
inf=i
while i<n and programme[i]==3:
i+=1
chaines.append((inf,i-1))
i+=1
for inf,sup in chaines:
precedent=programme[inf-1]
suivant=programme[sup+1]
longueur=sup-inf+1
if precedent==0 and suivant==0:
remplir(inf,sup,1)
elif precedent!=0:
remplir(inf,sup,antagoniste[precedent])
else:
if longueur%2==0:
remplir(inf,sup,suivant)
else:
remplir(inf,sup,antagoniste[suivant])
nombreRepos=0
for i in range(n-1):
if programme[i]==0 or programme[i]==programme[i+1]:
nombreRepos+=1
if programme[n-1]==0:
nombreRepos+=1
print(nombreRepos-2)
| Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya has *n* days of vacations! So he decided to improve his IT skills and do sport. Vasya knows the following information about each of this *n* days: whether that gym opened and whether a contest was carried out in the Internet on that day. For the *i*-th day there are four options:
1. on this day the gym is closed and the contest is not carried out; 1. on this day the gym is closed and the contest is carried out; 1. on this day the gym is open and the contest is not carried out; 1. on this day the gym is open and the contest is carried out.
On each of days Vasya can either have a rest or write the contest (if it is carried out on this day), or do sport (if the gym is open on this day).
Find the minimum number of days on which Vasya will have a rest (it means, he will not do sport and write the contest at the same time). The only limitation that Vasya has — he does not want to do the same activity on two consecutive days: it means, he will not do sport on two consecutive days, and write the contest on two consecutive days.
Input Specification:
The first line contains a positive integer *n* (1<=≤<=*n*<=≤<=100) — the number of days of Vasya's vacations.
The second line contains the sequence of integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=3) separated by space, where:
- *a**i* equals 0, if on the *i*-th day of vacations the gym is closed and the contest is not carried out; - *a**i* equals 1, if on the *i*-th day of vacations the gym is closed, but the contest is carried out; - *a**i* equals 2, if on the *i*-th day of vacations the gym is open and the contest is not carried out; - *a**i* equals 3, if on the *i*-th day of vacations the gym is open and the contest is carried out.
Output Specification:
Print the minimum possible number of days on which Vasya will have a rest. Remember that Vasya refuses:
- to do sport on any two consecutive days, - to write the contest on any two consecutive days.
Demo Input:
['4\n1 3 2 0\n', '7\n1 3 3 2 1 2 3\n', '2\n2 2\n']
Demo Output:
['2\n', '0\n', '1\n']
Note:
In the first test Vasya can write the contest on the day number 1 and do sport on the day number 3. Thus, he will have a rest for only 2 days.
In the second test Vasya should write contests on days number 1, 3, 5 and 7, in other days do sport. Thus, he will not have a rest for a single day.
In the third test Vasya can do sport either on a day number 1 or number 2. He can not do sport in two days, because it will be contrary to the his limitation. Thus, he will have a rest for only one day. | ```python
from sys import stdin
def remplir(inf,sup,val):
global programme
for i in range(inf,sup+1):
programme[i]=val
val=(val+1)%2
n=int(input())+2
programme=list(map(int,stdin.readline().split()))
programme=[0]+programme
programme.append(0)
chaines=[]
antagoniste=[0,2,1,3]
i=0
while i<n:
inf=i
while i<n and programme[i]==3:
i+=1
chaines.append((inf,i-1))
i+=1
for inf,sup in chaines:
precedent=programme[inf-1]
suivant=programme[sup+1]
longueur=sup-inf+1
if precedent==0 and suivant==0:
remplir(inf,sup,1)
elif precedent!=0:
remplir(inf,sup,antagoniste[precedent])
else:
if longueur%2==0:
remplir(inf,sup,suivant)
else:
remplir(inf,sup,antagoniste[suivant])
nombreRepos=0
for i in range(n-1):
if programme[i]==0 or programme[i]==programme[i+1]:
nombreRepos+=1
if programme[n-1]==0:
nombreRepos+=1
print(nombreRepos-2)
``` | 0 | |
839 | A | Arya and Bran | PROGRAMMING | 900 | [
"implementation"
] | null | null | Bran and his older sister Arya are from the same house. Bran like candies so much, so Arya is going to give him some Candies.
At first, Arya and Bran have 0 Candies. There are *n* days, at the *i*-th day, Arya finds *a**i* candies in a box, that is given by the Many-Faced God. Every day she can give Bran at most 8 of her candies. If she don't give him the candies at the same day, they are saved for her and she can give them to him later.
Your task is to find the minimum number of days Arya needs to give Bran *k* candies before the end of the *n*-th day. Formally, you need to output the minimum day index to the end of which *k* candies will be given out (the days are indexed from 1 to *n*).
Print -1 if she can't give him *k* candies during *n* given days. | The first line contains two integers *n* and *k* (1<=≤<=*n*<=≤<=100, 1<=≤<=*k*<=≤<=10000).
The second line contains *n* integers *a*1,<=*a*2,<=*a*3,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=100). | If it is impossible for Arya to give Bran *k* candies within *n* days, print -1.
Otherwise print a single integer — the minimum number of days Arya needs to give Bran *k* candies before the end of the *n*-th day. | [
"2 3\n1 2\n",
"3 17\n10 10 10\n",
"1 9\n10\n"
] | [
"2",
"3",
"-1"
] | In the first sample, Arya can give Bran 3 candies in 2 days.
In the second sample, Arya can give Bran 17 candies in 3 days, because she can give him at most 8 candies per day.
In the third sample, Arya can't give Bran 9 candies, because she can give him at most 8 candies per day and she must give him the candies within 1 day. | 500 | [
{
"input": "2 3\n1 2",
"output": "2"
},
{
"input": "3 17\n10 10 10",
"output": "3"
},
{
"input": "1 9\n10",
"output": "-1"
},
{
"input": "10 70\n6 5 2 3 3 2 1 4 3 2",
"output": "-1"
},
{
"input": "20 140\n40 4 81 40 10 54 34 50 84 60 16 1 90 78 38 93 99 60 81 99",... | 1,643,627,934 | 2,147,483,647 | Python 3 | OK | TESTS | 60 | 31 | 0 | n, k = map(int, input().split())
v = list(map(int, input().split()))
t = 0
i = 0
for i in range(0, n):
t += v[i]
x = min(8, t)
k -= x
t -= x
if k <= 0:
break
print([i + 1, -1][k > 0])
| Title: Arya and Bran
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Bran and his older sister Arya are from the same house. Bran like candies so much, so Arya is going to give him some Candies.
At first, Arya and Bran have 0 Candies. There are *n* days, at the *i*-th day, Arya finds *a**i* candies in a box, that is given by the Many-Faced God. Every day she can give Bran at most 8 of her candies. If she don't give him the candies at the same day, they are saved for her and she can give them to him later.
Your task is to find the minimum number of days Arya needs to give Bran *k* candies before the end of the *n*-th day. Formally, you need to output the minimum day index to the end of which *k* candies will be given out (the days are indexed from 1 to *n*).
Print -1 if she can't give him *k* candies during *n* given days.
Input Specification:
The first line contains two integers *n* and *k* (1<=≤<=*n*<=≤<=100, 1<=≤<=*k*<=≤<=10000).
The second line contains *n* integers *a*1,<=*a*2,<=*a*3,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=100).
Output Specification:
If it is impossible for Arya to give Bran *k* candies within *n* days, print -1.
Otherwise print a single integer — the minimum number of days Arya needs to give Bran *k* candies before the end of the *n*-th day.
Demo Input:
['2 3\n1 2\n', '3 17\n10 10 10\n', '1 9\n10\n']
Demo Output:
['2', '3', '-1']
Note:
In the first sample, Arya can give Bran 3 candies in 2 days.
In the second sample, Arya can give Bran 17 candies in 3 days, because she can give him at most 8 candies per day.
In the third sample, Arya can't give Bran 9 candies, because she can give him at most 8 candies per day and she must give him the candies within 1 day. | ```python
n, k = map(int, input().split())
v = list(map(int, input().split()))
t = 0
i = 0
for i in range(0, n):
t += v[i]
x = min(8, t)
k -= x
t -= x
if k <= 0:
break
print([i + 1, -1][k > 0])
``` | 3 | |
894 | A | QAQ | PROGRAMMING | 800 | [
"brute force",
"dp"
] | null | null | "QAQ" is a word to denote an expression of crying. Imagine "Q" as eyes with tears and "A" as a mouth.
Now Diamond has given Bort a string consisting of only uppercase English letters of length *n*. There is a great number of "QAQ" in the string (Diamond is so cute!).
Bort wants to know how many subsequences "QAQ" are in the string Diamond has given. Note that the letters "QAQ" don't have to be consecutive, but the order of letters should be exact. | The only line contains a string of length *n* (1<=≤<=*n*<=≤<=100). It's guaranteed that the string only contains uppercase English letters. | Print a single integer — the number of subsequences "QAQ" in the string. | [
"QAQAQYSYIOIWIN\n",
"QAQQQZZYNOIWIN\n"
] | [
"4\n",
"3\n"
] | In the first example there are 4 subsequences "QAQ": "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN". | 500 | [
{
"input": "QAQAQYSYIOIWIN",
"output": "4"
},
{
"input": "QAQQQZZYNOIWIN",
"output": "3"
},
{
"input": "QA",
"output": "0"
},
{
"input": "IAQVAQZLQBQVQFTQQQADAQJA",
"output": "24"
},
{
"input": "QQAAQASGAYAAAAKAKAQIQEAQAIAAIAQQQQQ",
"output": "378"
},
{
... | 1,617,297,759 | 2,147,483,647 | Python 3 | OK | TESTS | 43 | 62 | 0 | a=input()
print(sum(a[:i].count('Q')*a[i:].count('Q') for i in range(len(a)) if a[i]=='A')) | Title: QAQ
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
"QAQ" is a word to denote an expression of crying. Imagine "Q" as eyes with tears and "A" as a mouth.
Now Diamond has given Bort a string consisting of only uppercase English letters of length *n*. There is a great number of "QAQ" in the string (Diamond is so cute!).
Bort wants to know how many subsequences "QAQ" are in the string Diamond has given. Note that the letters "QAQ" don't have to be consecutive, but the order of letters should be exact.
Input Specification:
The only line contains a string of length *n* (1<=≤<=*n*<=≤<=100). It's guaranteed that the string only contains uppercase English letters.
Output Specification:
Print a single integer — the number of subsequences "QAQ" in the string.
Demo Input:
['QAQAQYSYIOIWIN\n', 'QAQQQZZYNOIWIN\n']
Demo Output:
['4\n', '3\n']
Note:
In the first example there are 4 subsequences "QAQ": "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN". | ```python
a=input()
print(sum(a[:i].count('Q')*a[i:].count('Q') for i in range(len(a)) if a[i]=='A'))
``` | 3 | |
272 | A | Dima and Friends | PROGRAMMING | 1,000 | [
"implementation",
"math"
] | null | null | Dima and his friends have been playing hide and seek at Dima's place all night. As a result, Dima's place got messy. In the morning they decided that they need to clean the place.
To decide who exactly would clean the apartment, the friends want to play a counting-out game. First, all the guys stand in a circle, and then each of them shows some number of fingers on one hand (one to five), and then the boys count in a circle, starting from Dima, the number of people, respective to the total number of fingers shown. The person on who the countdown stops will clean the apartment.
For example, if Dima and one of his friends played hide and seek, and 7 fingers were shown during the counting-out, then Dima would clean the place. If there were 2 or say, 8 fingers shown, then his friend would clean the place.
Dima knows how many fingers each of his friends will show during the counting-out. Now he is interested in the number of ways to show some number of fingers on one hand (one to five), so that he did not have to clean the place. Help Dima. | The first line contains integer *n* (1<=≤<=*n*<=≤<=100) — the number of Dima's friends. Dima himself isn't considered to be his own friend. The second line contains *n* positive integers, not exceeding 5, representing, how many fingers the Dima's friends will show.
The numbers in the lines are separated by a single space. | In a single line print the answer to the problem. | [
"1\n1\n",
"1\n2\n",
"2\n3 5\n"
] | [
"3\n",
"2\n",
"3\n"
] | In the first sample Dima can show 1, 3 or 5 fingers. If Dima shows 3 fingers, then the counting-out will go like that: Dima, his friend, Dima, his friend.
In the second sample Dima can show 2 or 4 fingers. | 500 | [
{
"input": "1\n1",
"output": "3"
},
{
"input": "1\n2",
"output": "2"
},
{
"input": "2\n3 5",
"output": "3"
},
{
"input": "2\n3 5",
"output": "3"
},
{
"input": "1\n5",
"output": "3"
},
{
"input": "5\n4 4 3 5 1",
"output": "4"
},
{
"input": "... | 1,682,695,919 | 2,147,483,647 | Python 3 | OK | TESTS | 30 | 92 | 0 | n=int(input())
f=list(map(int,input().split()))
b = sum(f)
c = 0
for x in range(1, 6):
if (x + b) % (n+1) != 1:
c += 1
print(c) | Title: Dima and Friends
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Dima and his friends have been playing hide and seek at Dima's place all night. As a result, Dima's place got messy. In the morning they decided that they need to clean the place.
To decide who exactly would clean the apartment, the friends want to play a counting-out game. First, all the guys stand in a circle, and then each of them shows some number of fingers on one hand (one to five), and then the boys count in a circle, starting from Dima, the number of people, respective to the total number of fingers shown. The person on who the countdown stops will clean the apartment.
For example, if Dima and one of his friends played hide and seek, and 7 fingers were shown during the counting-out, then Dima would clean the place. If there were 2 or say, 8 fingers shown, then his friend would clean the place.
Dima knows how many fingers each of his friends will show during the counting-out. Now he is interested in the number of ways to show some number of fingers on one hand (one to five), so that he did not have to clean the place. Help Dima.
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=100) — the number of Dima's friends. Dima himself isn't considered to be his own friend. The second line contains *n* positive integers, not exceeding 5, representing, how many fingers the Dima's friends will show.
The numbers in the lines are separated by a single space.
Output Specification:
In a single line print the answer to the problem.
Demo Input:
['1\n1\n', '1\n2\n', '2\n3 5\n']
Demo Output:
['3\n', '2\n', '3\n']
Note:
In the first sample Dima can show 1, 3 or 5 fingers. If Dima shows 3 fingers, then the counting-out will go like that: Dima, his friend, Dima, his friend.
In the second sample Dima can show 2 or 4 fingers. | ```python
n=int(input())
f=list(map(int,input().split()))
b = sum(f)
c = 0
for x in range(1, 6):
if (x + b) % (n+1) != 1:
c += 1
print(c)
``` | 3 | |
43 | A | Football | PROGRAMMING | 1,000 | [
"strings"
] | A. Football | 2 | 256 | One day Vasya decided to have a look at the results of Berland 1910 Football Championship’s finals. Unfortunately he didn't find the overall score of the match; however, he got hold of a profound description of the match's process. On the whole there are *n* lines in that description each of which described one goal. Every goal was marked with the name of the team that had scored it. Help Vasya, learn the name of the team that won the finals. It is guaranteed that the match did not end in a tie. | The first line contains an integer *n* (1<=≤<=*n*<=≤<=100) — the number of lines in the description. Then follow *n* lines — for each goal the names of the teams that scored it. The names are non-empty lines consisting of uppercase Latin letters whose lengths do not exceed 10 symbols. It is guaranteed that the match did not end in a tie and the description contains no more than two different teams. | Print the name of the winning team. We remind you that in football the team that scores more goals is considered the winner. | [
"1\nABC\n",
"5\nA\nABA\nABA\nA\nA\n"
] | [
"ABC\n",
"A\n"
] | none | 500 | [
{
"input": "1\nABC",
"output": "ABC"
},
{
"input": "5\nA\nABA\nABA\nA\nA",
"output": "A"
},
{
"input": "2\nXTSJEP\nXTSJEP",
"output": "XTSJEP"
},
{
"input": "3\nXZYDJAEDZ\nXZYDJAEDZ\nXZYDJAEDZ",
"output": "XZYDJAEDZ"
},
{
"input": "3\nQCCYXL\nQCCYXL\nAXGLFQDD",
... | 1,657,288,179 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 1 | 60 | 0 | dic={}
for i in range(int(input())):
goal=input()
if goal in dic.keys():
dic[goal]+=1
else:
dic[goal]=1
print(max(dic)) | Title: Football
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
One day Vasya decided to have a look at the results of Berland 1910 Football Championship’s finals. Unfortunately he didn't find the overall score of the match; however, he got hold of a profound description of the match's process. On the whole there are *n* lines in that description each of which described one goal. Every goal was marked with the name of the team that had scored it. Help Vasya, learn the name of the team that won the finals. It is guaranteed that the match did not end in a tie.
Input Specification:
The first line contains an integer *n* (1<=≤<=*n*<=≤<=100) — the number of lines in the description. Then follow *n* lines — for each goal the names of the teams that scored it. The names are non-empty lines consisting of uppercase Latin letters whose lengths do not exceed 10 symbols. It is guaranteed that the match did not end in a tie and the description contains no more than two different teams.
Output Specification:
Print the name of the winning team. We remind you that in football the team that scores more goals is considered the winner.
Demo Input:
['1\nABC\n', '5\nA\nABA\nABA\nA\nA\n']
Demo Output:
['ABC\n', 'A\n']
Note:
none | ```python
dic={}
for i in range(int(input())):
goal=input()
if goal in dic.keys():
dic[goal]+=1
else:
dic[goal]=1
print(max(dic))
``` | 0 |
41 | A | Translation | PROGRAMMING | 800 | [
"implementation",
"strings"
] | A. Translation | 2 | 256 | The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly. | The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols. | If the word *t* is a word *s*, written reversely, print YES, otherwise print NO. | [
"code\nedoc\n",
"abb\naba\n",
"code\ncode\n"
] | [
"YES\n",
"NO\n",
"NO\n"
] | none | 500 | [
{
"input": "code\nedoc",
"output": "YES"
},
{
"input": "abb\naba",
"output": "NO"
},
{
"input": "code\ncode",
"output": "NO"
},
{
"input": "abacaba\nabacaba",
"output": "YES"
},
{
"input": "q\nq",
"output": "YES"
},
{
"input": "asrgdfngfnmfgnhweratgjkk... | 1,612,180,684 | 2,147,483,647 | Python 3 | OK | TESTS | 40 | 124 | 0 | t = input()
s = input()
if(s=="".join(reversed(t))):
print('YES')
else:
print('NO')
| Title: Translation
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly.
Input Specification:
The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols.
Output Specification:
If the word *t* is a word *s*, written reversely, print YES, otherwise print NO.
Demo Input:
['code\nedoc\n', 'abb\naba\n', 'code\ncode\n']
Demo Output:
['YES\n', 'NO\n', 'NO\n']
Note:
none | ```python
t = input()
s = input()
if(s=="".join(reversed(t))):
print('YES')
else:
print('NO')
``` | 3.969 |
608 | B | Hamming Distance Sum | PROGRAMMING | 1,500 | [
"combinatorics",
"strings"
] | null | null | Genos needs your help. He was asked to solve the following programming problem by Saitama:
The length of some string *s* is denoted |*s*|. The Hamming distance between two strings *s* and *t* of equal length is defined as , where *s**i* is the *i*-th character of *s* and *t**i* is the *i*-th character of *t*. For example, the Hamming distance between string "0011" and string "0110" is |0<=-<=0|<=+<=|0<=-<=1|<=+<=|1<=-<=1|<=+<=|1<=-<=0|<==<=0<=+<=1<=+<=0<=+<=1<==<=2.
Given two binary strings *a* and *b*, find the sum of the Hamming distances between *a* and all contiguous substrings of *b* of length |*a*|. | The first line of the input contains binary string *a* (1<=≤<=|*a*|<=≤<=200<=000).
The second line of the input contains binary string *b* (|*a*|<=≤<=|*b*|<=≤<=200<=000).
Both strings are guaranteed to consist of characters '0' and '1' only. | Print a single integer — the sum of Hamming distances between *a* and all contiguous substrings of *b* of length |*a*|. | [
"01\n00111\n",
"0011\n0110\n"
] | [
"3\n",
"2\n"
] | For the first sample case, there are four contiguous substrings of *b* of length |*a*|: "00", "01", "11", and "11". The distance between "01" and "00" is |0 - 0| + |1 - 0| = 1. The distance between "01" and "01" is |0 - 0| + |1 - 1| = 0. The distance between "01" and "11" is |0 - 1| + |1 - 1| = 1. Last distance counts twice, as there are two occurrences of string "11". The sum of these edit distances is 1 + 0 + 1 + 1 = 3.
The second sample case is described in the statement. | 1,000 | [
{
"input": "01\n00111",
"output": "3"
},
{
"input": "0011\n0110",
"output": "2"
},
{
"input": "0\n0",
"output": "0"
},
{
"input": "1\n0",
"output": "1"
},
{
"input": "0\n1",
"output": "1"
},
{
"input": "1\n1",
"output": "0"
},
{
"input": "1... | 1,651,488,509 | 2,147,483,647 | Python 3 | TIME_LIMIT_EXCEEDED | TESTS | 8 | 2,000 | 78,028,800 | x=input()
y=input()
sum=''
i=0
lx=len(x)
while(i+lx<=len(y)):
ans=int(x,2) ^ int(y[i:i+lx],2)
ans=bin(ans)[2:]
sum+=ans
i+=1
out=sum.count("1")
print(out)
| Title: Hamming Distance Sum
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Genos needs your help. He was asked to solve the following programming problem by Saitama:
The length of some string *s* is denoted |*s*|. The Hamming distance between two strings *s* and *t* of equal length is defined as , where *s**i* is the *i*-th character of *s* and *t**i* is the *i*-th character of *t*. For example, the Hamming distance between string "0011" and string "0110" is |0<=-<=0|<=+<=|0<=-<=1|<=+<=|1<=-<=1|<=+<=|1<=-<=0|<==<=0<=+<=1<=+<=0<=+<=1<==<=2.
Given two binary strings *a* and *b*, find the sum of the Hamming distances between *a* and all contiguous substrings of *b* of length |*a*|.
Input Specification:
The first line of the input contains binary string *a* (1<=≤<=|*a*|<=≤<=200<=000).
The second line of the input contains binary string *b* (|*a*|<=≤<=|*b*|<=≤<=200<=000).
Both strings are guaranteed to consist of characters '0' and '1' only.
Output Specification:
Print a single integer — the sum of Hamming distances between *a* and all contiguous substrings of *b* of length |*a*|.
Demo Input:
['01\n00111\n', '0011\n0110\n']
Demo Output:
['3\n', '2\n']
Note:
For the first sample case, there are four contiguous substrings of *b* of length |*a*|: "00", "01", "11", and "11". The distance between "01" and "00" is |0 - 0| + |1 - 0| = 1. The distance between "01" and "01" is |0 - 0| + |1 - 1| = 0. The distance between "01" and "11" is |0 - 1| + |1 - 1| = 1. Last distance counts twice, as there are two occurrences of string "11". The sum of these edit distances is 1 + 0 + 1 + 1 = 3.
The second sample case is described in the statement. | ```python
x=input()
y=input()
sum=''
i=0
lx=len(x)
while(i+lx<=len(y)):
ans=int(x,2) ^ int(y[i:i+lx],2)
ans=bin(ans)[2:]
sum+=ans
i+=1
out=sum.count("1")
print(out)
``` | 0 | |
59 | A | Word | PROGRAMMING | 800 | [
"implementation",
"strings"
] | A. Word | 2 | 256 | Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word. | The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100. | Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one. | [
"HoUse\n",
"ViP\n",
"maTRIx\n"
] | [
"house\n",
"VIP\n",
"matrix\n"
] | none | 500 | [
{
"input": "HoUse",
"output": "house"
},
{
"input": "ViP",
"output": "VIP"
},
{
"input": "maTRIx",
"output": "matrix"
},
{
"input": "BNHWpnpawg",
"output": "bnhwpnpawg"
},
{
"input": "VTYGP",
"output": "VTYGP"
},
{
"input": "CHNenu",
"output": "chn... | 1,614,921,166 | 2,147,483,647 | Python 3 | OK | TESTS | 30 | 124 | 0 | s=input()
c1=c2=0
for i in range(len(s)):
if s[i].islower():
c1=c1+1
elif s[i].isupper():
c2=c2+1
if c1>c2 or c1==c2:
s=s.lower()
elif c2>c1:
s=s.upper()
print(s)
| Title: Word
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word.
Input Specification:
The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100.
Output Specification:
Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one.
Demo Input:
['HoUse\n', 'ViP\n', 'maTRIx\n']
Demo Output:
['house\n', 'VIP\n', 'matrix\n']
Note:
none | ```python
s=input()
c1=c2=0
for i in range(len(s)):
if s[i].islower():
c1=c1+1
elif s[i].isupper():
c2=c2+1
if c1>c2 or c1==c2:
s=s.lower()
elif c2>c1:
s=s.upper()
print(s)
``` | 3.969 |
25 | A | IQ test | PROGRAMMING | 1,300 | [
"brute force"
] | A. IQ test | 2 | 256 | Bob is preparing to pass IQ test. The most frequent task in this test is to find out which one of the given *n* numbers differs from the others. Bob observed that one number usually differs from the others in evenness. Help Bob — to check his answers, he needs a program that among the given *n* numbers finds one that is different in evenness. | The first line contains integer *n* (3<=≤<=*n*<=≤<=100) — amount of numbers in the task. The second line contains *n* space-separated natural numbers, not exceeding 100. It is guaranteed, that exactly one of these numbers differs from the others in evenness. | Output index of number that differs from the others in evenness. Numbers are numbered from 1 in the input order. | [
"5\n2 4 7 8 10\n",
"4\n1 2 1 1\n"
] | [
"3\n",
"2\n"
] | none | 0 | [
{
"input": "5\n2 4 7 8 10",
"output": "3"
},
{
"input": "4\n1 2 1 1",
"output": "2"
},
{
"input": "3\n1 2 2",
"output": "1"
},
{
"input": "3\n100 99 100",
"output": "2"
},
{
"input": "3\n5 3 2",
"output": "3"
},
{
"input": "4\n43 28 1 91",
"output"... | 1,610,403,747 | 2,147,483,647 | PyPy 3 | OK | TESTS | 32 | 186 | 0 | if __name__ == '__main__':
n = int(input())
ls = list(map(int, input().split()))
evens = []
odds = []
for x in ls:
if x % 2 == 0:
evens.append(x)
else:
odds.append(x)
if len(odds) == 1:
x = odds[0]
else:
x = evens[0]
for i in range(len(ls)):
if ls[i] == x:
print(i+1)
break
| Title: IQ test
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Bob is preparing to pass IQ test. The most frequent task in this test is to find out which one of the given *n* numbers differs from the others. Bob observed that one number usually differs from the others in evenness. Help Bob — to check his answers, he needs a program that among the given *n* numbers finds one that is different in evenness.
Input Specification:
The first line contains integer *n* (3<=≤<=*n*<=≤<=100) — amount of numbers in the task. The second line contains *n* space-separated natural numbers, not exceeding 100. It is guaranteed, that exactly one of these numbers differs from the others in evenness.
Output Specification:
Output index of number that differs from the others in evenness. Numbers are numbered from 1 in the input order.
Demo Input:
['5\n2 4 7 8 10\n', '4\n1 2 1 1\n']
Demo Output:
['3\n', '2\n']
Note:
none | ```python
if __name__ == '__main__':
n = int(input())
ls = list(map(int, input().split()))
evens = []
odds = []
for x in ls:
if x % 2 == 0:
evens.append(x)
else:
odds.append(x)
if len(odds) == 1:
x = odds[0]
else:
x = evens[0]
for i in range(len(ls)):
if ls[i] == x:
print(i+1)
break
``` | 3.9535 |
978 | A | Remove Duplicates | PROGRAMMING | 800 | [
"implementation"
] | null | null | Petya has an array $a$ consisting of $n$ integers. He wants to remove duplicate (equal) elements.
Petya wants to leave only the rightmost entry (occurrence) for each element of the array. The relative order of the remaining unique elements should not be changed. | The first line contains a single integer $n$ ($1 \le n \le 50$) — the number of elements in Petya's array.
The following line contains a sequence $a_1, a_2, \dots, a_n$ ($1 \le a_i \le 1\,000$) — the Petya's array. | In the first line print integer $x$ — the number of elements which will be left in Petya's array after he removed the duplicates.
In the second line print $x$ integers separated with a space — Petya's array after he removed the duplicates. For each unique element only the rightmost entry should be left. | [
"6\n1 5 5 1 6 1\n",
"5\n2 4 2 4 4\n",
"5\n6 6 6 6 6\n"
] | [
"3\n5 6 1 \n",
"2\n2 4 \n",
"1\n6 \n"
] | In the first example you should remove two integers $1$, which are in the positions $1$ and $4$. Also you should remove the integer $5$, which is in the position $2$.
In the second example you should remove integer $2$, which is in the position $1$, and two integers $4$, which are in the positions $2$ and $4$.
In the third example you should remove four integers $6$, which are in the positions $1$, $2$, $3$ and $4$. | 0 | [
{
"input": "6\n1 5 5 1 6 1",
"output": "3\n5 6 1 "
},
{
"input": "5\n2 4 2 4 4",
"output": "2\n2 4 "
},
{
"input": "5\n6 6 6 6 6",
"output": "1\n6 "
},
{
"input": "7\n1 2 3 4 2 2 3",
"output": "4\n1 4 2 3 "
},
{
"input": "9\n100 100 100 99 99 99 100 100 100",
... | 1,681,739,088 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 28 | 93 | 0 | n=int(input())
s=list(map(int,input().split()))[::-1]
g=[]
for i in s:
if i not in g:
g.append(i)
print(len(g))
print(*g[::-1]) | Title: Remove Duplicates
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Petya has an array $a$ consisting of $n$ integers. He wants to remove duplicate (equal) elements.
Petya wants to leave only the rightmost entry (occurrence) for each element of the array. The relative order of the remaining unique elements should not be changed.
Input Specification:
The first line contains a single integer $n$ ($1 \le n \le 50$) — the number of elements in Petya's array.
The following line contains a sequence $a_1, a_2, \dots, a_n$ ($1 \le a_i \le 1\,000$) — the Petya's array.
Output Specification:
In the first line print integer $x$ — the number of elements which will be left in Petya's array after he removed the duplicates.
In the second line print $x$ integers separated with a space — Petya's array after he removed the duplicates. For each unique element only the rightmost entry should be left.
Demo Input:
['6\n1 5 5 1 6 1\n', '5\n2 4 2 4 4\n', '5\n6 6 6 6 6\n']
Demo Output:
['3\n5 6 1 \n', '2\n2 4 \n', '1\n6 \n']
Note:
In the first example you should remove two integers $1$, which are in the positions $1$ and $4$. Also you should remove the integer $5$, which is in the position $2$.
In the second example you should remove integer $2$, which is in the position $1$, and two integers $4$, which are in the positions $2$ and $4$.
In the third example you should remove four integers $6$, which are in the positions $1$, $2$, $3$ and $4$. | ```python
n=int(input())
s=list(map(int,input().split()))[::-1]
g=[]
for i in s:
if i not in g:
g.append(i)
print(len(g))
print(*g[::-1])
``` | 3 | |
219 | A | k-String | PROGRAMMING | 1,000 | [
"implementation",
"strings"
] | null | null | A string is called a *k*-string if it can be represented as *k* concatenated copies of some string. For example, the string "aabaabaabaab" is at the same time a 1-string, a 2-string and a 4-string, but it is not a 3-string, a 5-string, or a 6-string and so on. Obviously any string is a 1-string.
You are given a string *s*, consisting of lowercase English letters and a positive integer *k*. Your task is to reorder the letters in the string *s* in such a way that the resulting string is a *k*-string. | The first input line contains integer *k* (1<=≤<=*k*<=≤<=1000). The second line contains *s*, all characters in *s* are lowercase English letters. The string length *s* satisfies the inequality 1<=≤<=|*s*|<=≤<=1000, where |*s*| is the length of string *s*. | Rearrange the letters in string *s* in such a way that the result is a *k*-string. Print the result on a single output line. If there are multiple solutions, print any of them.
If the solution doesn't exist, print "-1" (without quotes). | [
"2\naazz\n",
"3\nabcabcabz\n"
] | [
"azaz\n",
"-1\n"
] | none | 500 | [
{
"input": "2\naazz",
"output": "azaz"
},
{
"input": "3\nabcabcabz",
"output": "-1"
},
{
"input": "1\na",
"output": "a"
},
{
"input": "2\nabba",
"output": "abab"
},
{
"input": "2\naaab",
"output": "-1"
},
{
"input": "7\nabacaba",
"output": "-1"
}... | 1,634,157,994 | 2,147,483,647 | PyPy 3 | OK | TESTS | 42 | 216 | 102,400 | from collections import Counter
def solve():
k=int(input())
s=list(input())
c=Counter(s)
ans=''
for key,v in c.items():
if v%k:
return -1
ans+=(key)*(v//k)
return ans*k
print(solve()) | Title: k-String
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A string is called a *k*-string if it can be represented as *k* concatenated copies of some string. For example, the string "aabaabaabaab" is at the same time a 1-string, a 2-string and a 4-string, but it is not a 3-string, a 5-string, or a 6-string and so on. Obviously any string is a 1-string.
You are given a string *s*, consisting of lowercase English letters and a positive integer *k*. Your task is to reorder the letters in the string *s* in such a way that the resulting string is a *k*-string.
Input Specification:
The first input line contains integer *k* (1<=≤<=*k*<=≤<=1000). The second line contains *s*, all characters in *s* are lowercase English letters. The string length *s* satisfies the inequality 1<=≤<=|*s*|<=≤<=1000, where |*s*| is the length of string *s*.
Output Specification:
Rearrange the letters in string *s* in such a way that the result is a *k*-string. Print the result on a single output line. If there are multiple solutions, print any of them.
If the solution doesn't exist, print "-1" (without quotes).
Demo Input:
['2\naazz\n', '3\nabcabcabz\n']
Demo Output:
['azaz\n', '-1\n']
Note:
none | ```python
from collections import Counter
def solve():
k=int(input())
s=list(input())
c=Counter(s)
ans=''
for key,v in c.items():
if v%k:
return -1
ans+=(key)*(v//k)
return ans*k
print(solve())
``` | 3 | |
867 | A | Between the Offices | PROGRAMMING | 800 | [
"implementation"
] | null | null | As you may know, MemSQL has American offices in both San Francisco and Seattle. Being a manager in the company, you travel a lot between the two cities, always by plane.
You prefer flying from Seattle to San Francisco than in the other direction, because it's warmer in San Francisco. You are so busy that you don't remember the number of flights you have made in either direction. However, for each of the last *n* days you know whether you were in San Francisco office or in Seattle office. You always fly at nights, so you never were at both offices on the same day. Given this information, determine if you flew more times from Seattle to San Francisco during the last *n* days, or not. | The first line of input contains single integer *n* (2<=≤<=*n*<=≤<=100) — the number of days.
The second line contains a string of length *n* consisting of only capital 'S' and 'F' letters. If the *i*-th letter is 'S', then you were in Seattle office on that day. Otherwise you were in San Francisco. The days are given in chronological order, i.e. today is the last day in this sequence. | Print "YES" if you flew more times from Seattle to San Francisco, and "NO" otherwise.
You can print each letter in any case (upper or lower). | [
"4\nFSSF\n",
"2\nSF\n",
"10\nFFFFFFFFFF\n",
"10\nSSFFSFFSFF\n"
] | [
"NO\n",
"YES\n",
"NO\n",
"YES\n"
] | In the first example you were initially at San Francisco, then flew to Seattle, were there for two days and returned to San Francisco. You made one flight in each direction, so the answer is "NO".
In the second example you just flew from Seattle to San Francisco, so the answer is "YES".
In the third example you stayed the whole period in San Francisco, so the answer is "NO".
In the fourth example if you replace 'S' with ones, and 'F' with zeros, you'll get the first few digits of π in binary representation. Not very useful information though. | 500 | [
{
"input": "4\nFSSF",
"output": "NO"
},
{
"input": "2\nSF",
"output": "YES"
},
{
"input": "10\nFFFFFFFFFF",
"output": "NO"
},
{
"input": "10\nSSFFSFFSFF",
"output": "YES"
},
{
"input": "20\nSFSFFFFSSFFFFSSSSFSS",
"output": "NO"
},
{
"input": "20\nSSFFF... | 1,666,102,293 | 2,147,483,647 | Python 3 | OK | TESTS | 34 | 46 | 0 | #867A Between the offices
#SSFFSFFSFF
n=int(input())
s=input()
x=0
y=0
previous=s[0]
for current in s[1:]:
if previous=='S' and current=='F':
x+=1
elif previous=='F' and current=='S':
y+=1
previous=current
if x>y:
print("YES")
else:
print("NO") | Title: Between the Offices
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
As you may know, MemSQL has American offices in both San Francisco and Seattle. Being a manager in the company, you travel a lot between the two cities, always by plane.
You prefer flying from Seattle to San Francisco than in the other direction, because it's warmer in San Francisco. You are so busy that you don't remember the number of flights you have made in either direction. However, for each of the last *n* days you know whether you were in San Francisco office or in Seattle office. You always fly at nights, so you never were at both offices on the same day. Given this information, determine if you flew more times from Seattle to San Francisco during the last *n* days, or not.
Input Specification:
The first line of input contains single integer *n* (2<=≤<=*n*<=≤<=100) — the number of days.
The second line contains a string of length *n* consisting of only capital 'S' and 'F' letters. If the *i*-th letter is 'S', then you were in Seattle office on that day. Otherwise you were in San Francisco. The days are given in chronological order, i.e. today is the last day in this sequence.
Output Specification:
Print "YES" if you flew more times from Seattle to San Francisco, and "NO" otherwise.
You can print each letter in any case (upper or lower).
Demo Input:
['4\nFSSF\n', '2\nSF\n', '10\nFFFFFFFFFF\n', '10\nSSFFSFFSFF\n']
Demo Output:
['NO\n', 'YES\n', 'NO\n', 'YES\n']
Note:
In the first example you were initially at San Francisco, then flew to Seattle, were there for two days and returned to San Francisco. You made one flight in each direction, so the answer is "NO".
In the second example you just flew from Seattle to San Francisco, so the answer is "YES".
In the third example you stayed the whole period in San Francisco, so the answer is "NO".
In the fourth example if you replace 'S' with ones, and 'F' with zeros, you'll get the first few digits of π in binary representation. Not very useful information though. | ```python
#867A Between the offices
#SSFFSFFSFF
n=int(input())
s=input()
x=0
y=0
previous=s[0]
for current in s[1:]:
if previous=='S' and current=='F':
x+=1
elif previous=='F' and current=='S':
y+=1
previous=current
if x>y:
print("YES")
else:
print("NO")
``` | 3 | |
550 | A | Two Substrings | PROGRAMMING | 1,500 | [
"brute force",
"dp",
"greedy",
"implementation",
"strings"
] | null | null | You are given string *s*. Your task is to determine if the given string *s* contains two non-overlapping substrings "AB" and "BA" (the substrings can go in any order). | The only line of input contains a string *s* of length between 1 and 105 consisting of uppercase Latin letters. | Print "YES" (without the quotes), if string *s* contains two non-overlapping substrings "AB" and "BA", and "NO" otherwise. | [
"ABA\n",
"BACFAB\n",
"AXBYBXA\n"
] | [
"NO\n",
"YES\n",
"NO\n"
] | In the first sample test, despite the fact that there are substrings "AB" and "BA", their occurrences overlap, so the answer is "NO".
In the second sample test there are the following occurrences of the substrings: BACFAB.
In the third sample test there is no substring "AB" nor substring "BA". | 1,000 | [
{
"input": "ABA",
"output": "NO"
},
{
"input": "BACFAB",
"output": "YES"
},
{
"input": "AXBYBXA",
"output": "NO"
},
{
"input": "ABABAB",
"output": "YES"
},
{
"input": "BBBBBBBBBB",
"output": "NO"
},
{
"input": "ABBA",
"output": "YES"
},
{
"... | 1,697,987,565 | 2,147,483,647 | PyPy 3 | OK | TESTS | 85 | 92 | 614,400 | s = input()
sAB = s.find("AB")
sBA = s.find("BA")
if sAB != -1 and sBA != -1 and abs(sAB - sBA) > 1:
print("YES")
else:
if "AB" in s and "BA" in s[s.index("AB") + 2:]:
print("YES")
exit()
if "BA" in s and "AB" in s[s.index("BA") + 2:]:
print("YES")
exit()
else:
print("NO")
| Title: Two Substrings
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given string *s*. Your task is to determine if the given string *s* contains two non-overlapping substrings "AB" and "BA" (the substrings can go in any order).
Input Specification:
The only line of input contains a string *s* of length between 1 and 105 consisting of uppercase Latin letters.
Output Specification:
Print "YES" (without the quotes), if string *s* contains two non-overlapping substrings "AB" and "BA", and "NO" otherwise.
Demo Input:
['ABA\n', 'BACFAB\n', 'AXBYBXA\n']
Demo Output:
['NO\n', 'YES\n', 'NO\n']
Note:
In the first sample test, despite the fact that there are substrings "AB" and "BA", their occurrences overlap, so the answer is "NO".
In the second sample test there are the following occurrences of the substrings: BACFAB.
In the third sample test there is no substring "AB" nor substring "BA". | ```python
s = input()
sAB = s.find("AB")
sBA = s.find("BA")
if sAB != -1 and sBA != -1 and abs(sAB - sBA) > 1:
print("YES")
else:
if "AB" in s and "BA" in s[s.index("AB") + 2:]:
print("YES")
exit()
if "BA" in s and "AB" in s[s.index("BA") + 2:]:
print("YES")
exit()
else:
print("NO")
``` | 3 | |
285 | B | Find Marble | PROGRAMMING | 1,200 | [
"implementation"
] | null | null | Petya and Vasya are playing a game. Petya's got *n* non-transparent glasses, standing in a row. The glasses' positions are indexed with integers from 1 to *n* from left to right. Note that the positions are indexed but the glasses are not.
First Petya puts a marble under the glass in position *s*. Then he performs some (possibly zero) shuffling operations. One shuffling operation means moving the glass from the first position to position *p*1, the glass from the second position to position *p*2 and so on. That is, a glass goes from position *i* to position *p**i*. Consider all glasses are moving simultaneously during one shuffling operation. When the glasses are shuffled, the marble doesn't travel from one glass to another: it moves together with the glass it was initially been put in.
After all shuffling operations Petya shows Vasya that the ball has moved to position *t*. Vasya's task is to say what minimum number of shuffling operations Petya has performed or determine that Petya has made a mistake and the marble could not have got from position *s* to position *t*. | The first line contains three integers: *n*,<=*s*,<=*t* (1<=≤<=*n*<=≤<=105; 1<=≤<=*s*,<=*t*<=≤<=*n*) — the number of glasses, the ball's initial and final position. The second line contains *n* space-separated integers: *p*1,<=*p*2,<=...,<=*p**n* (1<=≤<=*p**i*<=≤<=*n*) — the shuffling operation parameters. It is guaranteed that all *p**i*'s are distinct.
Note that *s* can equal *t*. | If the marble can move from position *s* to position *t*, then print on a single line a non-negative integer — the minimum number of shuffling operations, needed to get the marble to position *t*. If it is impossible, print number -1. | [
"4 2 1\n2 3 4 1\n",
"4 3 3\n4 1 3 2\n",
"4 3 4\n1 2 3 4\n",
"3 1 3\n2 1 3\n"
] | [
"3\n",
"0\n",
"-1\n",
"-1\n"
] | none | 1,000 | [
{
"input": "4 2 1\n2 3 4 1",
"output": "3"
},
{
"input": "4 3 3\n4 1 3 2",
"output": "0"
},
{
"input": "4 3 4\n1 2 3 4",
"output": "-1"
},
{
"input": "3 1 3\n2 1 3",
"output": "-1"
},
{
"input": "1 1 1\n1",
"output": "0"
},
{
"input": "10 6 7\n10 7 8 1... | 1,658,487,139 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 33 | 186 | 14,131,200 | import sys
import math
input = sys.stdin.readline
from collections import defaultdict
n, s, t = map(int, input().split())
lst = list(map(int, input().split()))
if s == t:
print(0)
exit()
# for i in range(n):
# if lst[i] == i+1 or lst[lst[i] - 1] == lst[i]:
# print(-1)
# exit()
p = lst[s-1]
count = 1
while t != p:
p = lst[p-1]
count += 1
if count > n:
print(-1)
exit()
print(count) | Title: Find Marble
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Petya and Vasya are playing a game. Petya's got *n* non-transparent glasses, standing in a row. The glasses' positions are indexed with integers from 1 to *n* from left to right. Note that the positions are indexed but the glasses are not.
First Petya puts a marble under the glass in position *s*. Then he performs some (possibly zero) shuffling operations. One shuffling operation means moving the glass from the first position to position *p*1, the glass from the second position to position *p*2 and so on. That is, a glass goes from position *i* to position *p**i*. Consider all glasses are moving simultaneously during one shuffling operation. When the glasses are shuffled, the marble doesn't travel from one glass to another: it moves together with the glass it was initially been put in.
After all shuffling operations Petya shows Vasya that the ball has moved to position *t*. Vasya's task is to say what minimum number of shuffling operations Petya has performed or determine that Petya has made a mistake and the marble could not have got from position *s* to position *t*.
Input Specification:
The first line contains three integers: *n*,<=*s*,<=*t* (1<=≤<=*n*<=≤<=105; 1<=≤<=*s*,<=*t*<=≤<=*n*) — the number of glasses, the ball's initial and final position. The second line contains *n* space-separated integers: *p*1,<=*p*2,<=...,<=*p**n* (1<=≤<=*p**i*<=≤<=*n*) — the shuffling operation parameters. It is guaranteed that all *p**i*'s are distinct.
Note that *s* can equal *t*.
Output Specification:
If the marble can move from position *s* to position *t*, then print on a single line a non-negative integer — the minimum number of shuffling operations, needed to get the marble to position *t*. If it is impossible, print number -1.
Demo Input:
['4 2 1\n2 3 4 1\n', '4 3 3\n4 1 3 2\n', '4 3 4\n1 2 3 4\n', '3 1 3\n2 1 3\n']
Demo Output:
['3\n', '0\n', '-1\n', '-1\n']
Note:
none | ```python
import sys
import math
input = sys.stdin.readline
from collections import defaultdict
n, s, t = map(int, input().split())
lst = list(map(int, input().split()))
if s == t:
print(0)
exit()
# for i in range(n):
# if lst[i] == i+1 or lst[lst[i] - 1] == lst[i]:
# print(-1)
# exit()
p = lst[s-1]
count = 1
while t != p:
p = lst[p-1]
count += 1
if count > n:
print(-1)
exit()
print(count)
``` | 3 | |
476 | A | Dreamoon and Stairs | PROGRAMMING | 1,000 | [
"implementation",
"math"
] | null | null | Dreamoon wants to climb up a stair of *n* steps. He can climb 1 or 2 steps at each move. Dreamoon wants the number of moves to be a multiple of an integer *m*.
What is the minimal number of moves making him climb to the top of the stairs that satisfies his condition? | The single line contains two space separated integers *n*, *m* (0<=<<=*n*<=≤<=10000,<=1<=<<=*m*<=≤<=10). | Print a single integer — the minimal number of moves being a multiple of *m*. If there is no way he can climb satisfying condition print <=-<=1 instead. | [
"10 2\n",
"3 5\n"
] | [
"6\n",
"-1\n"
] | For the first sample, Dreamoon could climb in 6 moves with following sequence of steps: {2, 2, 2, 2, 1, 1}.
For the second sample, there are only three valid sequence of steps {2, 1}, {1, 2}, {1, 1, 1} with 2, 2, and 3 steps respectively. All these numbers are not multiples of 5. | 500 | [
{
"input": "10 2",
"output": "6"
},
{
"input": "3 5",
"output": "-1"
},
{
"input": "29 7",
"output": "21"
},
{
"input": "2 2",
"output": "2"
},
{
"input": "1 2",
"output": "-1"
},
{
"input": "10000 2",
"output": "5000"
},
{
"input": "10000 ... | 1,682,145,335 | 2,147,483,647 | Python 3 | OK | TESTS | 35 | 46 | 0 | stairs, multiple = map(int, input().split())
twos = 0
ones = 0
if stairs < multiple:
print(-1)
if stairs % 2 == 0:
twos = stairs // 2
ones = 0
else:
twos = stairs // 2
ones = 1
# check = True
# if (stairs / multiple)
while twos >= 0:
if (twos + ones) % multiple == 0:
print(twos + ones)
break
else:
twos -= 1
ones += 2
| Title: Dreamoon and Stairs
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Dreamoon wants to climb up a stair of *n* steps. He can climb 1 or 2 steps at each move. Dreamoon wants the number of moves to be a multiple of an integer *m*.
What is the minimal number of moves making him climb to the top of the stairs that satisfies his condition?
Input Specification:
The single line contains two space separated integers *n*, *m* (0<=<<=*n*<=≤<=10000,<=1<=<<=*m*<=≤<=10).
Output Specification:
Print a single integer — the minimal number of moves being a multiple of *m*. If there is no way he can climb satisfying condition print <=-<=1 instead.
Demo Input:
['10 2\n', '3 5\n']
Demo Output:
['6\n', '-1\n']
Note:
For the first sample, Dreamoon could climb in 6 moves with following sequence of steps: {2, 2, 2, 2, 1, 1}.
For the second sample, there are only three valid sequence of steps {2, 1}, {1, 2}, {1, 1, 1} with 2, 2, and 3 steps respectively. All these numbers are not multiples of 5. | ```python
stairs, multiple = map(int, input().split())
twos = 0
ones = 0
if stairs < multiple:
print(-1)
if stairs % 2 == 0:
twos = stairs // 2
ones = 0
else:
twos = stairs // 2
ones = 1
# check = True
# if (stairs / multiple)
while twos >= 0:
if (twos + ones) % multiple == 0:
print(twos + ones)
break
else:
twos -= 1
ones += 2
``` | 3 | |
391 | A | Genetic Engineering | PROGRAMMING | 0 | [
"implementation",
"two pointers"
] | null | null | You will receive 3 points for solving this problem.
Manao is designing the genetic code for a new type of algae to efficiently produce fuel. Specifically, Manao is focusing on a stretch of DNA that encodes one protein. The stretch of DNA is represented by a string containing only the characters 'A', 'T', 'G' and 'C'.
Manao has determined that if the stretch of DNA contains a maximal sequence of consecutive identical nucleotides that is of even length, then the protein will be nonfunctional. For example, consider a protein described by DNA string "GTTAAAG". It contains four maximal sequences of consecutive identical nucleotides: "G", "TT", "AAA", and "G". The protein is nonfunctional because sequence "TT" has even length.
Manao is trying to obtain a functional protein from the protein he currently has. Manao can insert additional nucleotides into the DNA stretch. Each additional nucleotide is a character from the set {'A', 'T', 'G', 'C'}. Manao wants to determine the minimum number of insertions necessary to make the DNA encode a functional protein. | The input consists of a single line, containing a string *s* of length *n* (1<=≤<=*n*<=≤<=100). Each character of *s* will be from the set {'A', 'T', 'G', 'C'}.
This problem doesn't have subproblems. You will get 3 points for the correct submission. | The program should print on one line a single integer representing the minimum number of 'A', 'T', 'G', 'C' characters that are required to be inserted into the input string in order to make all runs of identical characters have odd length. | [
"GTTAAAG\n",
"AACCAACCAAAAC\n"
] | [
"1\n",
"5\n"
] | In the first example, it is sufficient to insert a single nucleotide of any type between the two 'T's in the sequence to restore the functionality of the protein. | 3 | [
{
"input": "GTTAAAG",
"output": "1"
},
{
"input": "AACCAACCAAAAC",
"output": "5"
},
{
"input": "GTGAATTTCC",
"output": "2"
},
{
"input": "CAGGGGGCCGCCCATGAAAAAAACCCGGCCCCTTGGGAAAACTTGGGTTA",
"output": "7"
},
{
"input": "CCCTTCACCCGGATCCAAATCCCTTAGAAATAATCCCCGACGGC... | 1,561,211,370 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 0 | 93 | 0 | tot=1
ans=0
a=input()
l=len(a)
i=1
while i<l+1:
if a[i]==a[i-1]:
tot+=1
else:
if tot%2==0:
ans+=1
tot=1
i+=1
print(ans) | Title: Genetic Engineering
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You will receive 3 points for solving this problem.
Manao is designing the genetic code for a new type of algae to efficiently produce fuel. Specifically, Manao is focusing on a stretch of DNA that encodes one protein. The stretch of DNA is represented by a string containing only the characters 'A', 'T', 'G' and 'C'.
Manao has determined that if the stretch of DNA contains a maximal sequence of consecutive identical nucleotides that is of even length, then the protein will be nonfunctional. For example, consider a protein described by DNA string "GTTAAAG". It contains four maximal sequences of consecutive identical nucleotides: "G", "TT", "AAA", and "G". The protein is nonfunctional because sequence "TT" has even length.
Manao is trying to obtain a functional protein from the protein he currently has. Manao can insert additional nucleotides into the DNA stretch. Each additional nucleotide is a character from the set {'A', 'T', 'G', 'C'}. Manao wants to determine the minimum number of insertions necessary to make the DNA encode a functional protein.
Input Specification:
The input consists of a single line, containing a string *s* of length *n* (1<=≤<=*n*<=≤<=100). Each character of *s* will be from the set {'A', 'T', 'G', 'C'}.
This problem doesn't have subproblems. You will get 3 points for the correct submission.
Output Specification:
The program should print on one line a single integer representing the minimum number of 'A', 'T', 'G', 'C' characters that are required to be inserted into the input string in order to make all runs of identical characters have odd length.
Demo Input:
['GTTAAAG\n', 'AACCAACCAAAAC\n']
Demo Output:
['1\n', '5\n']
Note:
In the first example, it is sufficient to insert a single nucleotide of any type between the two 'T's in the sequence to restore the functionality of the protein. | ```python
tot=1
ans=0
a=input()
l=len(a)
i=1
while i<l+1:
if a[i]==a[i-1]:
tot+=1
else:
if tot%2==0:
ans+=1
tot=1
i+=1
print(ans)
``` | -1 | |
631 | C | Report | PROGRAMMING | 1,700 | [
"data structures",
"sortings"
] | null | null | Each month Blake gets the report containing main economic indicators of the company "Blake Technologies". There are *n* commodities produced by the company. For each of them there is exactly one integer in the final report, that denotes corresponding revenue. Before the report gets to Blake, it passes through the hands of *m* managers. Each of them may reorder the elements in some order. Namely, the *i*-th manager either sorts first *r**i* numbers in non-descending or non-ascending order and then passes the report to the manager *i*<=+<=1, or directly to Blake (if this manager has number *i*<==<=*m*).
Employees of the "Blake Technologies" are preparing the report right now. You know the initial sequence *a**i* of length *n* and the description of each manager, that is value *r**i* and his favourite order. You are asked to speed up the process and determine how the final report will look like. | The first line of the input contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=200<=000) — the number of commodities in the report and the number of managers, respectively.
The second line contains *n* integers *a**i* (|*a**i*|<=≤<=109) — the initial report before it gets to the first manager.
Then follow *m* lines with the descriptions of the operations managers are going to perform. The *i*-th of these lines contains two integers *t**i* and *r**i* (, 1<=≤<=*r**i*<=≤<=*n*), meaning that the *i*-th manager sorts the first *r**i* numbers either in the non-descending (if *t**i*<==<=1) or non-ascending (if *t**i*<==<=2) order. | Print *n* integers — the final report, which will be passed to Blake by manager number *m*. | [
"3 1\n1 2 3\n2 2\n",
"4 2\n1 2 4 3\n2 3\n1 2\n"
] | [
"2 1 3 ",
"2 4 1 3 "
] | In the first sample, the initial report looked like: 1 2 3. After the first manager the first two numbers were transposed: 2 1 3. The report got to Blake in this form.
In the second sample the original report was like this: 1 2 4 3. After the first manager the report changed to: 4 2 1 3. After the second manager the report changed to: 2 4 1 3. This report was handed over to Blake. | 1,500 | [
{
"input": "3 1\n1 2 3\n2 2",
"output": "2 1 3 "
},
{
"input": "4 2\n1 2 4 3\n2 3\n1 2",
"output": "2 4 1 3 "
},
{
"input": "4 1\n4 3 2 1\n1 4",
"output": "1 2 3 4 "
},
{
"input": "5 1\n1 2 3 4 5\n2 5",
"output": "5 4 3 2 1 "
},
{
"input": "6 2\n3 1 2 6 4 5\n1 6\n... | 1,459,433,197 | 2,147,483,647 | Python 3 | TIME_LIMIT_EXCEEDED | TESTS | 23 | 2,000 | 20,992,000 | a, b = (int(i) for i in input().split())
f = list(map(int,input().split()))
d = []
for i in range(b):
c, e = (int(t) for t in input().split())
while len(d) > 0 and e > d[-1][1]:
d.pop()
d.append([c, e])
c, e = 0, d[0][1]
d.append([0, 0])
g = sorted(f[:e])
for i in range(1,len(d)):
for y in range(d[i - 1][1], d[i][1], -1):
if d[i - 1][0] == 1:
f[y - 1] = g[-1]
del g[-1]
else:
f[y - 1] = g[0]
del g[0]
for i in range(len(f)):
print(f[i],end = ' ')
| Title: Report
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Each month Blake gets the report containing main economic indicators of the company "Blake Technologies". There are *n* commodities produced by the company. For each of them there is exactly one integer in the final report, that denotes corresponding revenue. Before the report gets to Blake, it passes through the hands of *m* managers. Each of them may reorder the elements in some order. Namely, the *i*-th manager either sorts first *r**i* numbers in non-descending or non-ascending order and then passes the report to the manager *i*<=+<=1, or directly to Blake (if this manager has number *i*<==<=*m*).
Employees of the "Blake Technologies" are preparing the report right now. You know the initial sequence *a**i* of length *n* and the description of each manager, that is value *r**i* and his favourite order. You are asked to speed up the process and determine how the final report will look like.
Input Specification:
The first line of the input contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=200<=000) — the number of commodities in the report and the number of managers, respectively.
The second line contains *n* integers *a**i* (|*a**i*|<=≤<=109) — the initial report before it gets to the first manager.
Then follow *m* lines with the descriptions of the operations managers are going to perform. The *i*-th of these lines contains two integers *t**i* and *r**i* (, 1<=≤<=*r**i*<=≤<=*n*), meaning that the *i*-th manager sorts the first *r**i* numbers either in the non-descending (if *t**i*<==<=1) or non-ascending (if *t**i*<==<=2) order.
Output Specification:
Print *n* integers — the final report, which will be passed to Blake by manager number *m*.
Demo Input:
['3 1\n1 2 3\n2 2\n', '4 2\n1 2 4 3\n2 3\n1 2\n']
Demo Output:
['2 1 3 ', '2 4 1 3 ']
Note:
In the first sample, the initial report looked like: 1 2 3. After the first manager the first two numbers were transposed: 2 1 3. The report got to Blake in this form.
In the second sample the original report was like this: 1 2 4 3. After the first manager the report changed to: 4 2 1 3. After the second manager the report changed to: 2 4 1 3. This report was handed over to Blake. | ```python
a, b = (int(i) for i in input().split())
f = list(map(int,input().split()))
d = []
for i in range(b):
c, e = (int(t) for t in input().split())
while len(d) > 0 and e > d[-1][1]:
d.pop()
d.append([c, e])
c, e = 0, d[0][1]
d.append([0, 0])
g = sorted(f[:e])
for i in range(1,len(d)):
for y in range(d[i - 1][1], d[i][1], -1):
if d[i - 1][0] == 1:
f[y - 1] = g[-1]
del g[-1]
else:
f[y - 1] = g[0]
del g[0]
for i in range(len(f)):
print(f[i],end = ' ')
``` | 0 | |
854 | A | Fraction | PROGRAMMING | 800 | [
"brute force",
"constructive algorithms",
"math"
] | null | null | Petya is a big fan of mathematics, especially its part related to fractions. Recently he learned that a fraction is called proper iff its numerator is smaller than its denominator (*a*<=<<=*b*) and that the fraction is called irreducible if its numerator and its denominator are coprime (they do not have positive common divisors except 1).
During his free time, Petya thinks about proper irreducible fractions and converts them to decimals using the calculator. One day he mistakenly pressed addition button (<=+<=) instead of division button (÷) and got sum of numerator and denominator that was equal to *n* instead of the expected decimal notation.
Petya wanted to restore the original fraction, but soon he realized that it might not be done uniquely. That's why he decided to determine maximum possible proper irreducible fraction such that sum of its numerator and denominator equals *n*. Help Petya deal with this problem. | In the only line of input there is an integer *n* (3<=≤<=*n*<=≤<=1000), the sum of numerator and denominator of the fraction. | Output two space-separated positive integers *a* and *b*, numerator and denominator of the maximum possible proper irreducible fraction satisfying the given sum. | [
"3\n",
"4\n",
"12\n"
] | [
"1 2\n",
"1 3\n",
"5 7\n"
] | none | 500 | [
{
"input": "3",
"output": "1 2"
},
{
"input": "4",
"output": "1 3"
},
{
"input": "12",
"output": "5 7"
},
{
"input": "34",
"output": "15 19"
},
{
"input": "13",
"output": "6 7"
},
{
"input": "11",
"output": "5 6"
},
{
"input": "24",
"ou... | 1,544,249,143 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 5 | 124 | 0 | n = int(input())
m = 0
l = []
d = []
for i in range(1, n):
for j in range(1, n):
x = 0
if i + j == n and i < j and i / j > m:
for a in range(2, i//2+1):
if i % a == 0:
d.append(a)
for a in d:
if j % a == 0:
x = 1
if x == 1:
continue
else:
m = i / j
l = [i, j]
print(*l) | Title: Fraction
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Petya is a big fan of mathematics, especially its part related to fractions. Recently he learned that a fraction is called proper iff its numerator is smaller than its denominator (*a*<=<<=*b*) and that the fraction is called irreducible if its numerator and its denominator are coprime (they do not have positive common divisors except 1).
During his free time, Petya thinks about proper irreducible fractions and converts them to decimals using the calculator. One day he mistakenly pressed addition button (<=+<=) instead of division button (÷) and got sum of numerator and denominator that was equal to *n* instead of the expected decimal notation.
Petya wanted to restore the original fraction, but soon he realized that it might not be done uniquely. That's why he decided to determine maximum possible proper irreducible fraction such that sum of its numerator and denominator equals *n*. Help Petya deal with this problem.
Input Specification:
In the only line of input there is an integer *n* (3<=≤<=*n*<=≤<=1000), the sum of numerator and denominator of the fraction.
Output Specification:
Output two space-separated positive integers *a* and *b*, numerator and denominator of the maximum possible proper irreducible fraction satisfying the given sum.
Demo Input:
['3\n', '4\n', '12\n']
Demo Output:
['1 2\n', '1 3\n', '5 7\n']
Note:
none | ```python
n = int(input())
m = 0
l = []
d = []
for i in range(1, n):
for j in range(1, n):
x = 0
if i + j == n and i < j and i / j > m:
for a in range(2, i//2+1):
if i % a == 0:
d.append(a)
for a in d:
if j % a == 0:
x = 1
if x == 1:
continue
else:
m = i / j
l = [i, j]
print(*l)
``` | 0 | |
757 | A | Gotta Catch Em' All! | PROGRAMMING | 1,000 | [
"implementation"
] | null | null | Bash wants to become a Pokemon master one day. Although he liked a lot of Pokemon, he has always been fascinated by Bulbasaur the most. Soon, things started getting serious and his fascination turned into an obsession. Since he is too young to go out and catch Bulbasaur, he came up with his own way of catching a Bulbasaur.
Each day, he takes the front page of the newspaper. He cuts out the letters one at a time, from anywhere on the front page of the newspaper to form the word "Bulbasaur" (without quotes) and sticks it on his wall. Bash is very particular about case — the first letter of "Bulbasaur" must be upper case and the rest must be lower case. By doing this he thinks he has caught one Bulbasaur. He then repeats this step on the left over part of the newspaper. He keeps doing this until it is not possible to form the word "Bulbasaur" from the newspaper.
Given the text on the front page of the newspaper, can you tell how many Bulbasaurs he will catch today?
Note: uppercase and lowercase letters are considered different. | Input contains a single line containing a string *s* (1<=<=≤<=<=|*s*|<=<=≤<=<=105) — the text on the front page of the newspaper without spaces and punctuation marks. |*s*| is the length of the string *s*.
The string *s* contains lowercase and uppercase English letters, i.e. . | Output a single integer, the answer to the problem. | [
"Bulbbasaur\n",
"F\n",
"aBddulbasaurrgndgbualdBdsagaurrgndbb\n"
] | [
"1\n",
"0\n",
"2\n"
] | In the first case, you could pick: Bulbbasaur.
In the second case, there is no way to pick even a single Bulbasaur.
In the third case, you can rearrange the string to BulbasaurBulbasauraddrgndgddgargndbb to get two words "Bulbasaur". | 500 | [
{
"input": "Bulbbasaur",
"output": "1"
},
{
"input": "F",
"output": "0"
},
{
"input": "aBddulbasaurrgndgbualdBdsagaurrgndbb",
"output": "2"
},
{
"input": "BBBBBBBBBBbbbbbbbbbbuuuuuuuuuullllllllllssssssssssaaaaaaaaaarrrrrrrrrr",
"output": "5"
},
{
"input": "BBBBBBB... | 1,484,340,511 | 2,147,483,647 | Python 3 | TIME_LIMIT_EXCEEDED | TESTS | 12 | 1,000 | 4,812,800 | x=input()
s=x
w=0
d=set('Bulbasaur')
for i in range(len(s)):
if 'B' in s and 'u' in s and 'l' in s and 'b' in s and 'a' in s and 's' in s and 'a' in s and 'u' in s and 'r' in s:
w+=1
s=s.replace('B','',1)
s=s.replace('u','',1)
s=s.replace('l','',1)
s=s.replace('b','',1)
s=s.replace('a','',1)
s=s.replace('s','',1)
s=s.replace('a','',1)
s=s.replace('u','',1)
s=s.replace('r','',1)
print(w)
| Title: Gotta Catch Em' All!
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Bash wants to become a Pokemon master one day. Although he liked a lot of Pokemon, he has always been fascinated by Bulbasaur the most. Soon, things started getting serious and his fascination turned into an obsession. Since he is too young to go out and catch Bulbasaur, he came up with his own way of catching a Bulbasaur.
Each day, he takes the front page of the newspaper. He cuts out the letters one at a time, from anywhere on the front page of the newspaper to form the word "Bulbasaur" (without quotes) and sticks it on his wall. Bash is very particular about case — the first letter of "Bulbasaur" must be upper case and the rest must be lower case. By doing this he thinks he has caught one Bulbasaur. He then repeats this step on the left over part of the newspaper. He keeps doing this until it is not possible to form the word "Bulbasaur" from the newspaper.
Given the text on the front page of the newspaper, can you tell how many Bulbasaurs he will catch today?
Note: uppercase and lowercase letters are considered different.
Input Specification:
Input contains a single line containing a string *s* (1<=<=≤<=<=|*s*|<=<=≤<=<=105) — the text on the front page of the newspaper without spaces and punctuation marks. |*s*| is the length of the string *s*.
The string *s* contains lowercase and uppercase English letters, i.e. .
Output Specification:
Output a single integer, the answer to the problem.
Demo Input:
['Bulbbasaur\n', 'F\n', 'aBddulbasaurrgndgbualdBdsagaurrgndbb\n']
Demo Output:
['1\n', '0\n', '2\n']
Note:
In the first case, you could pick: Bulbbasaur.
In the second case, there is no way to pick even a single Bulbasaur.
In the third case, you can rearrange the string to BulbasaurBulbasauraddrgndgddgargndbb to get two words "Bulbasaur". | ```python
x=input()
s=x
w=0
d=set('Bulbasaur')
for i in range(len(s)):
if 'B' in s and 'u' in s and 'l' in s and 'b' in s and 'a' in s and 's' in s and 'a' in s and 'u' in s and 'r' in s:
w+=1
s=s.replace('B','',1)
s=s.replace('u','',1)
s=s.replace('l','',1)
s=s.replace('b','',1)
s=s.replace('a','',1)
s=s.replace('s','',1)
s=s.replace('a','',1)
s=s.replace('u','',1)
s=s.replace('r','',1)
print(w)
``` | 0 | |
387 | B | George and Round | PROGRAMMING | 1,200 | [
"brute force",
"greedy",
"two pointers"
] | null | null | George decided to prepare a Codesecrof round, so he has prepared *m* problems for the round. Let's number the problems with integers 1 through *m*. George estimates the *i*-th problem's complexity by integer *b**i*.
To make the round good, he needs to put at least *n* problems there. Besides, he needs to have at least one problem with complexity exactly *a*1, at least one with complexity exactly *a*2, ..., and at least one with complexity exactly *a**n*. Of course, the round can also have problems with other complexities.
George has a poor imagination. It's easier for him to make some already prepared problem simpler than to come up with a new one and prepare it. George is magnificent at simplifying problems. He can simplify any already prepared problem with complexity *c* to any positive integer complexity *d* (*c*<=≥<=*d*), by changing limits on the input data.
However, nothing is so simple. George understood that even if he simplifies some problems, he can run out of problems for a good round. That's why he decided to find out the minimum number of problems he needs to come up with in addition to the *m* he's prepared in order to make a good round. Note that George can come up with a new problem of any complexity. | The first line contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=3000) — the minimal number of problems in a good round and the number of problems George's prepared. The second line contains space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a*1<=<<=*a*2<=<<=...<=<<=*a**n*<=≤<=106) — the requirements for the complexity of the problems in a good round. The third line contains space-separated integers *b*1,<=*b*2,<=...,<=*b**m* (1<=≤<=*b*1<=≤<=*b*2...<=≤<=*b**m*<=≤<=106) — the complexities of the problems prepared by George. | Print a single integer — the answer to the problem. | [
"3 5\n1 2 3\n1 2 2 3 3\n",
"3 5\n1 2 3\n1 1 1 1 1\n",
"3 1\n2 3 4\n1\n"
] | [
"0\n",
"2\n",
"3\n"
] | In the first sample the set of the prepared problems meets the requirements for a good round.
In the second sample, it is enough to come up with and prepare two problems with complexities 2 and 3 to get a good round.
In the third sample it is very easy to get a good round if come up with and prepare extra problems with complexities: 2, 3, 4. | 1,000 | [
{
"input": "3 5\n1 2 3\n1 2 2 3 3",
"output": "0"
},
{
"input": "3 5\n1 2 3\n1 1 1 1 1",
"output": "2"
},
{
"input": "3 1\n2 3 4\n1",
"output": "3"
},
{
"input": "29 100\n20 32 41 67 72 155 331 382 399 412 465 470 484 511 515 529 616 637 679 715 733 763 826 843 862 903 925 97... | 1,578,445,596 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 3 | 93 | 307,200 | n, m = map(int, input().split())
a = list(map(int, input().split()))
b = list(map(int, input().split()))
c = [0]*(3000 + 1)
count = 0
dif = m - n
for i in b:
c[i] += 1
for i in a:
if c[i] == 0:
count += 1
if dif >= 0 and count == 0:
print(0)
else:
if abs(dif) > count:
print(dif)
else:
print(count)
| Title: George and Round
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
George decided to prepare a Codesecrof round, so he has prepared *m* problems for the round. Let's number the problems with integers 1 through *m*. George estimates the *i*-th problem's complexity by integer *b**i*.
To make the round good, he needs to put at least *n* problems there. Besides, he needs to have at least one problem with complexity exactly *a*1, at least one with complexity exactly *a*2, ..., and at least one with complexity exactly *a**n*. Of course, the round can also have problems with other complexities.
George has a poor imagination. It's easier for him to make some already prepared problem simpler than to come up with a new one and prepare it. George is magnificent at simplifying problems. He can simplify any already prepared problem with complexity *c* to any positive integer complexity *d* (*c*<=≥<=*d*), by changing limits on the input data.
However, nothing is so simple. George understood that even if he simplifies some problems, he can run out of problems for a good round. That's why he decided to find out the minimum number of problems he needs to come up with in addition to the *m* he's prepared in order to make a good round. Note that George can come up with a new problem of any complexity.
Input Specification:
The first line contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=3000) — the minimal number of problems in a good round and the number of problems George's prepared. The second line contains space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a*1<=<<=*a*2<=<<=...<=<<=*a**n*<=≤<=106) — the requirements for the complexity of the problems in a good round. The third line contains space-separated integers *b*1,<=*b*2,<=...,<=*b**m* (1<=≤<=*b*1<=≤<=*b*2...<=≤<=*b**m*<=≤<=106) — the complexities of the problems prepared by George.
Output Specification:
Print a single integer — the answer to the problem.
Demo Input:
['3 5\n1 2 3\n1 2 2 3 3\n', '3 5\n1 2 3\n1 1 1 1 1\n', '3 1\n2 3 4\n1\n']
Demo Output:
['0\n', '2\n', '3\n']
Note:
In the first sample the set of the prepared problems meets the requirements for a good round.
In the second sample, it is enough to come up with and prepare two problems with complexities 2 and 3 to get a good round.
In the third sample it is very easy to get a good round if come up with and prepare extra problems with complexities: 2, 3, 4. | ```python
n, m = map(int, input().split())
a = list(map(int, input().split()))
b = list(map(int, input().split()))
c = [0]*(3000 + 1)
count = 0
dif = m - n
for i in b:
c[i] += 1
for i in a:
if c[i] == 0:
count += 1
if dif >= 0 and count == 0:
print(0)
else:
if abs(dif) > count:
print(dif)
else:
print(count)
``` | -1 | |
834 | B | The Festive Evening | PROGRAMMING | 1,100 | [
"data structures",
"implementation"
] | null | null | It's the end of July – the time when a festive evening is held at Jelly Castle! Guests from all over the kingdom gather here to discuss new trends in the world of confectionery. Yet some of the things discussed here are not supposed to be disclosed to the general public: the information can cause discord in the kingdom of Sweetland in case it turns out to reach the wrong hands. So it's a necessity to not let any uninvited guests in.
There are 26 entrances in Jelly Castle, enumerated with uppercase English letters from A to Z. Because of security measures, each guest is known to be assigned an entrance he should enter the castle through. The door of each entrance is opened right before the first guest's arrival and closed right after the arrival of the last guest that should enter the castle through this entrance. No two guests can enter the castle simultaneously.
For an entrance to be protected from possible intrusion, a candy guard should be assigned to it. There are *k* such guards in the castle, so if there are more than *k* opened doors, one of them is going to be left unguarded! Notice that a guard can't leave his post until the door he is assigned to is closed.
Slastyona had a suspicion that there could be uninvited guests at the evening. She knows the order in which the invited guests entered the castle, and wants you to help her check whether there was a moment when more than *k* doors were opened. | Two integers are given in the first string: the number of guests *n* and the number of guards *k* (1<=≤<=*n*<=≤<=106, 1<=≤<=*k*<=≤<=26).
In the second string, *n* uppercase English letters *s*1*s*2... *s**n* are given, where *s**i* is the entrance used by the *i*-th guest. | Output «YES» if at least one door was unguarded during some time, and «NO» otherwise.
You can output each letter in arbitrary case (upper or lower). | [
"5 1\nAABBB\n",
"5 1\nABABB\n"
] | [
"NO\n",
"YES\n"
] | In the first sample case, the door A is opened right before the first guest's arrival and closed when the second guest enters the castle. The door B is opened right before the arrival of the third guest, and closed after the fifth one arrives. One guard can handle both doors, as the first one is closed before the second one is opened.
In the second sample case, the door B is opened before the second guest's arrival, but the only guard can't leave the door A unattended, as there is still one more guest that should enter the castle through this door. | 1,000 | [
{
"input": "5 1\nAABBB",
"output": "NO"
},
{
"input": "5 1\nABABB",
"output": "YES"
},
{
"input": "26 1\nABCDEFGHIJKLMNOPQRSTUVWXYZ",
"output": "NO"
},
{
"input": "27 1\nABCDEFGHIJKLMNOPQRSTUVWXYZA",
"output": "YES"
},
{
"input": "5 2\nABACA",
"output": "NO"
... | 1,501,431,316 | 6,016 | Python 3 | WRONG_ANSWER | PRETESTS | 0 | 31 | 4,608,000 | n,k=map(int,input().split())
s=input()
gate=[False]*26
count=[0]*26
for i in range(n):
index=ord(s[i])-65
count[index]+=1
guard=0
exc=False
print(count)
for i in range(n):
index=ord(s[i])-65
if gate[index]:
count[index]-=1
if count[index]==0:
guard=guard-1
else:
count[index]-=1
gate[index]=True
guard=guard+1
if guard>k:
exc=True
break
if count[index]==0:
guard=guard-1
last=s[i]
print(s[i])
print(count)
print(gate)
if exc:
print("YES")
else :
print("NO") | Title: The Festive Evening
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
It's the end of July – the time when a festive evening is held at Jelly Castle! Guests from all over the kingdom gather here to discuss new trends in the world of confectionery. Yet some of the things discussed here are not supposed to be disclosed to the general public: the information can cause discord in the kingdom of Sweetland in case it turns out to reach the wrong hands. So it's a necessity to not let any uninvited guests in.
There are 26 entrances in Jelly Castle, enumerated with uppercase English letters from A to Z. Because of security measures, each guest is known to be assigned an entrance he should enter the castle through. The door of each entrance is opened right before the first guest's arrival and closed right after the arrival of the last guest that should enter the castle through this entrance. No two guests can enter the castle simultaneously.
For an entrance to be protected from possible intrusion, a candy guard should be assigned to it. There are *k* such guards in the castle, so if there are more than *k* opened doors, one of them is going to be left unguarded! Notice that a guard can't leave his post until the door he is assigned to is closed.
Slastyona had a suspicion that there could be uninvited guests at the evening. She knows the order in which the invited guests entered the castle, and wants you to help her check whether there was a moment when more than *k* doors were opened.
Input Specification:
Two integers are given in the first string: the number of guests *n* and the number of guards *k* (1<=≤<=*n*<=≤<=106, 1<=≤<=*k*<=≤<=26).
In the second string, *n* uppercase English letters *s*1*s*2... *s**n* are given, where *s**i* is the entrance used by the *i*-th guest.
Output Specification:
Output «YES» if at least one door was unguarded during some time, and «NO» otherwise.
You can output each letter in arbitrary case (upper or lower).
Demo Input:
['5 1\nAABBB\n', '5 1\nABABB\n']
Demo Output:
['NO\n', 'YES\n']
Note:
In the first sample case, the door A is opened right before the first guest's arrival and closed when the second guest enters the castle. The door B is opened right before the arrival of the third guest, and closed after the fifth one arrives. One guard can handle both doors, as the first one is closed before the second one is opened.
In the second sample case, the door B is opened before the second guest's arrival, but the only guard can't leave the door A unattended, as there is still one more guest that should enter the castle through this door. | ```python
n,k=map(int,input().split())
s=input()
gate=[False]*26
count=[0]*26
for i in range(n):
index=ord(s[i])-65
count[index]+=1
guard=0
exc=False
print(count)
for i in range(n):
index=ord(s[i])-65
if gate[index]:
count[index]-=1
if count[index]==0:
guard=guard-1
else:
count[index]-=1
gate[index]=True
guard=guard+1
if guard>k:
exc=True
break
if count[index]==0:
guard=guard-1
last=s[i]
print(s[i])
print(count)
print(gate)
if exc:
print("YES")
else :
print("NO")
``` | 0 | |
4 | A | Watermelon | PROGRAMMING | 800 | [
"brute force",
"math"
] | A. Watermelon | 1 | 64 | One hot summer day Pete and his friend Billy decided to buy a watermelon. They chose the biggest and the ripest one, in their opinion. After that the watermelon was weighed, and the scales showed *w* kilos. They rushed home, dying of thirst, and decided to divide the berry, however they faced a hard problem.
Pete and Billy are great fans of even numbers, that's why they want to divide the watermelon in such a way that each of the two parts weighs even number of kilos, at the same time it is not obligatory that the parts are equal. The boys are extremely tired and want to start their meal as soon as possible, that's why you should help them and find out, if they can divide the watermelon in the way they want. For sure, each of them should get a part of positive weight. | The first (and the only) input line contains integer number *w* (1<=≤<=*w*<=≤<=100) — the weight of the watermelon bought by the boys. | Print YES, if the boys can divide the watermelon into two parts, each of them weighing even number of kilos; and NO in the opposite case. | [
"8\n"
] | [
"YES\n"
] | For example, the boys can divide the watermelon into two parts of 2 and 6 kilos respectively (another variant — two parts of 4 and 4 kilos). | 0 | [
{
"input": "8",
"output": "YES"
},
{
"input": "5",
"output": "NO"
},
{
"input": "4",
"output": "YES"
},
{
"input": "3",
"output": "NO"
},
{
"input": "2",
"output": "NO"
},
{
"input": "1",
"output": "NO"
},
{
"input": "7",
"output": "NO"... | 1,688,627,273 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 4 | 60 | 0 | input=int(input())
if input%2==0:
print("YES")
elif input==0:
print("NO")
else:
print("NO") | Title: Watermelon
Time Limit: 1 seconds
Memory Limit: 64 megabytes
Problem Description:
One hot summer day Pete and his friend Billy decided to buy a watermelon. They chose the biggest and the ripest one, in their opinion. After that the watermelon was weighed, and the scales showed *w* kilos. They rushed home, dying of thirst, and decided to divide the berry, however they faced a hard problem.
Pete and Billy are great fans of even numbers, that's why they want to divide the watermelon in such a way that each of the two parts weighs even number of kilos, at the same time it is not obligatory that the parts are equal. The boys are extremely tired and want to start their meal as soon as possible, that's why you should help them and find out, if they can divide the watermelon in the way they want. For sure, each of them should get a part of positive weight.
Input Specification:
The first (and the only) input line contains integer number *w* (1<=≤<=*w*<=≤<=100) — the weight of the watermelon bought by the boys.
Output Specification:
Print YES, if the boys can divide the watermelon into two parts, each of them weighing even number of kilos; and NO in the opposite case.
Demo Input:
['8\n']
Demo Output:
['YES\n']
Note:
For example, the boys can divide the watermelon into two parts of 2 and 6 kilos respectively (another variant — two parts of 4 and 4 kilos). | ```python
input=int(input())
if input%2==0:
print("YES")
elif input==0:
print("NO")
else:
print("NO")
``` | 0 |
898 | C | Phone Numbers | PROGRAMMING | 1,400 | [
"implementation",
"strings"
] | null | null | Vasya has several phone books, in which he recorded the telephone numbers of his friends. Each of his friends can have one or several phone numbers.
Vasya decided to organize information about the phone numbers of friends. You will be given *n* strings — all entries from Vasya's phone books. Each entry starts with a friend's name. Then follows the number of phone numbers in the current entry, and then the phone numbers themselves. It is possible that several identical phones are recorded in the same record.
Vasya also believes that if the phone number *a* is a suffix of the phone number *b* (that is, the number *b* ends up with *a*), and both numbers are written by Vasya as the phone numbers of the same person, then *a* is recorded without the city code and it should not be taken into account.
The task is to print organized information about the phone numbers of Vasya's friends. It is possible that two different people have the same number. If one person has two numbers *x* and *y*, and *x* is a suffix of *y* (that is, *y* ends in *x*), then you shouldn't print number *x*. If the number of a friend in the Vasya's phone books is recorded several times in the same format, it is necessary to take it into account exactly once.
Read the examples to understand statement and format of the output better. | First line contains the integer *n* (1<=≤<=*n*<=≤<=20) — number of entries in Vasya's phone books.
The following *n* lines are followed by descriptions of the records in the format described in statement. Names of Vasya's friends are non-empty strings whose length does not exceed 10. They consists only of lowercase English letters. Number of phone numbers in one entry is not less than 1 is not more than 10. The telephone numbers consist of digits only. If you represent a phone number as a string, then its length will be in range from 1 to 10. Phone numbers can contain leading zeros. | Print out the ordered information about the phone numbers of Vasya's friends. First output *m* — number of friends that are found in Vasya's phone books.
The following *m* lines must contain entries in the following format "name number_of_phone_numbers phone_numbers". Phone numbers should be separated by a space. Each record must contain all the phone numbers of current friend.
Entries can be displayed in arbitrary order, phone numbers for one record can also be printed in arbitrary order. | [
"2\nivan 1 00123\nmasha 1 00123\n",
"3\nkarl 2 612 12\npetr 1 12\nkatya 1 612\n",
"4\nivan 3 123 123 456\nivan 2 456 456\nivan 8 789 3 23 6 56 9 89 2\ndasha 2 23 789\n"
] | [
"2\nmasha 1 00123 \nivan 1 00123 \n",
"3\nkatya 1 612 \npetr 1 12 \nkarl 1 612 \n",
"2\ndasha 2 23 789 \nivan 4 789 123 2 456 \n"
] | none | 1,500 | [
{
"input": "2\nivan 1 00123\nmasha 1 00123",
"output": "2\nmasha 1 00123 \nivan 1 00123 "
},
{
"input": "3\nkarl 2 612 12\npetr 1 12\nkatya 1 612",
"output": "3\nkatya 1 612 \npetr 1 12 \nkarl 1 612 "
},
{
"input": "4\nivan 3 123 123 456\nivan 2 456 456\nivan 8 789 3 23 6 56 9 89 2\ndash... | 1,666,451,508 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 59 | 62 | 0 | """ Prositka
10.10.2022"""
n=int(input())
d=dict()
for i in range(n):
a=input().split()
if a[0] not in d:
d[a[0]]=[]
for j in range(2, len(a)):
a[j]=a[j][::-1]
d[a[0]]+=a[2:]
print(len(d))
for x in d:
a=d[x]
a.sort(reverse=True)
b=[a[0]]
for i in range(1, len(a)):
if a[i-1][:len(a[i])]!=a[i]:
b+=[a[i]]
for i in range(len(b)):
b[i]=b[i][::-1]
print(x,len(b),*b) | Title: Phone Numbers
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya has several phone books, in which he recorded the telephone numbers of his friends. Each of his friends can have one or several phone numbers.
Vasya decided to organize information about the phone numbers of friends. You will be given *n* strings — all entries from Vasya's phone books. Each entry starts with a friend's name. Then follows the number of phone numbers in the current entry, and then the phone numbers themselves. It is possible that several identical phones are recorded in the same record.
Vasya also believes that if the phone number *a* is a suffix of the phone number *b* (that is, the number *b* ends up with *a*), and both numbers are written by Vasya as the phone numbers of the same person, then *a* is recorded without the city code and it should not be taken into account.
The task is to print organized information about the phone numbers of Vasya's friends. It is possible that two different people have the same number. If one person has two numbers *x* and *y*, and *x* is a suffix of *y* (that is, *y* ends in *x*), then you shouldn't print number *x*. If the number of a friend in the Vasya's phone books is recorded several times in the same format, it is necessary to take it into account exactly once.
Read the examples to understand statement and format of the output better.
Input Specification:
First line contains the integer *n* (1<=≤<=*n*<=≤<=20) — number of entries in Vasya's phone books.
The following *n* lines are followed by descriptions of the records in the format described in statement. Names of Vasya's friends are non-empty strings whose length does not exceed 10. They consists only of lowercase English letters. Number of phone numbers in one entry is not less than 1 is not more than 10. The telephone numbers consist of digits only. If you represent a phone number as a string, then its length will be in range from 1 to 10. Phone numbers can contain leading zeros.
Output Specification:
Print out the ordered information about the phone numbers of Vasya's friends. First output *m* — number of friends that are found in Vasya's phone books.
The following *m* lines must contain entries in the following format "name number_of_phone_numbers phone_numbers". Phone numbers should be separated by a space. Each record must contain all the phone numbers of current friend.
Entries can be displayed in arbitrary order, phone numbers for one record can also be printed in arbitrary order.
Demo Input:
['2\nivan 1 00123\nmasha 1 00123\n', '3\nkarl 2 612 12\npetr 1 12\nkatya 1 612\n', '4\nivan 3 123 123 456\nivan 2 456 456\nivan 8 789 3 23 6 56 9 89 2\ndasha 2 23 789\n']
Demo Output:
['2\nmasha 1 00123 \nivan 1 00123 \n', '3\nkatya 1 612 \npetr 1 12 \nkarl 1 612 \n', '2\ndasha 2 23 789 \nivan 4 789 123 2 456 \n']
Note:
none | ```python
""" Prositka
10.10.2022"""
n=int(input())
d=dict()
for i in range(n):
a=input().split()
if a[0] not in d:
d[a[0]]=[]
for j in range(2, len(a)):
a[j]=a[j][::-1]
d[a[0]]+=a[2:]
print(len(d))
for x in d:
a=d[x]
a.sort(reverse=True)
b=[a[0]]
for i in range(1, len(a)):
if a[i-1][:len(a[i])]!=a[i]:
b+=[a[i]]
for i in range(len(b)):
b[i]=b[i][::-1]
print(x,len(b),*b)
``` | 3 | |
851 | A | Arpa and a research in Mexican wave | PROGRAMMING | 800 | [
"implementation",
"math"
] | null | null | Arpa is researching the Mexican wave.
There are *n* spectators in the stadium, labeled from 1 to *n*. They start the Mexican wave at time 0.
- At time 1, the first spectator stands. - At time 2, the second spectator stands. - ... - At time *k*, the *k*-th spectator stands. - At time *k*<=+<=1, the (*k*<=+<=1)-th spectator stands and the first spectator sits. - At time *k*<=+<=2, the (*k*<=+<=2)-th spectator stands and the second spectator sits. - ... - At time *n*, the *n*-th spectator stands and the (*n*<=-<=*k*)-th spectator sits. - At time *n*<=+<=1, the (*n*<=+<=1<=-<=*k*)-th spectator sits. - ... - At time *n*<=+<=*k*, the *n*-th spectator sits.
Arpa wants to know how many spectators are standing at time *t*. | The first line contains three integers *n*, *k*, *t* (1<=≤<=*n*<=≤<=109, 1<=≤<=*k*<=≤<=*n*, 1<=≤<=*t*<=<<=*n*<=+<=*k*). | Print single integer: how many spectators are standing at time *t*. | [
"10 5 3\n",
"10 5 7\n",
"10 5 12\n"
] | [
"3\n",
"5\n",
"3\n"
] | In the following a sitting spectator is represented as -, a standing spectator is represented as ^.
- At *t* = 0 ---------- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 0. - At *t* = 1 ^--------- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 1. - At *t* = 2 ^^-------- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 2. - At *t* = 3 ^^^------- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 3. - At *t* = 4 ^^^^------ <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 4. - At *t* = 5 ^^^^^----- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 5. - At *t* = 6 -^^^^^---- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 5. - At *t* = 7 --^^^^^--- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 5. - At *t* = 8 ---^^^^^-- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 5. - At *t* = 9 ----^^^^^- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 5. - At *t* = 10 -----^^^^^ <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 5. - At *t* = 11 ------^^^^ <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 4. - At *t* = 12 -------^^^ <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 3. - At *t* = 13 --------^^ <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 2. - At *t* = 14 ---------^ <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 1. - At *t* = 15 ---------- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 0. | 500 | [
{
"input": "10 5 3",
"output": "3"
},
{
"input": "10 5 7",
"output": "5"
},
{
"input": "10 5 12",
"output": "3"
},
{
"input": "840585600 770678331 788528791",
"output": "770678331"
},
{
"input": "25462281 23343504 8024619",
"output": "8024619"
},
{
"in... | 1,504,536,077 | 377 | Python 3 | OK | TESTS | 166 | 78 | 0 | n,t,k = map(int,input().split())
if(t>k):
print(k)
elif(k>n):
print(t-(k-n))
else:
print(t) | Title: Arpa and a research in Mexican wave
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Arpa is researching the Mexican wave.
There are *n* spectators in the stadium, labeled from 1 to *n*. They start the Mexican wave at time 0.
- At time 1, the first spectator stands. - At time 2, the second spectator stands. - ... - At time *k*, the *k*-th spectator stands. - At time *k*<=+<=1, the (*k*<=+<=1)-th spectator stands and the first spectator sits. - At time *k*<=+<=2, the (*k*<=+<=2)-th spectator stands and the second spectator sits. - ... - At time *n*, the *n*-th spectator stands and the (*n*<=-<=*k*)-th spectator sits. - At time *n*<=+<=1, the (*n*<=+<=1<=-<=*k*)-th spectator sits. - ... - At time *n*<=+<=*k*, the *n*-th spectator sits.
Arpa wants to know how many spectators are standing at time *t*.
Input Specification:
The first line contains three integers *n*, *k*, *t* (1<=≤<=*n*<=≤<=109, 1<=≤<=*k*<=≤<=*n*, 1<=≤<=*t*<=<<=*n*<=+<=*k*).
Output Specification:
Print single integer: how many spectators are standing at time *t*.
Demo Input:
['10 5 3\n', '10 5 7\n', '10 5 12\n']
Demo Output:
['3\n', '5\n', '3\n']
Note:
In the following a sitting spectator is represented as -, a standing spectator is represented as ^.
- At *t* = 0 ---------- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 0. - At *t* = 1 ^--------- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 1. - At *t* = 2 ^^-------- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 2. - At *t* = 3 ^^^------- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 3. - At *t* = 4 ^^^^------ <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 4. - At *t* = 5 ^^^^^----- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 5. - At *t* = 6 -^^^^^---- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 5. - At *t* = 7 --^^^^^--- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 5. - At *t* = 8 ---^^^^^-- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 5. - At *t* = 9 ----^^^^^- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 5. - At *t* = 10 -----^^^^^ <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 5. - At *t* = 11 ------^^^^ <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 4. - At *t* = 12 -------^^^ <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 3. - At *t* = 13 --------^^ <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 2. - At *t* = 14 ---------^ <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 1. - At *t* = 15 ---------- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spectators = 0. | ```python
n,t,k = map(int,input().split())
if(t>k):
print(k)
elif(k>n):
print(t-(k-n))
else:
print(t)
``` | 3 | |
20 | B | Equation | PROGRAMMING | 2,000 | [
"math"
] | B. Equation | 1 | 256 | You are given an equation:
Your task is to find the number of distinct roots of the equation and print all of them in ascending order. | The first line contains three integer numbers *A*,<=*B* and *C* (<=-<=105<=≤<=*A*,<=*B*,<=*C*<=≤<=105). Any coefficient may be equal to 0. | In case of infinite root count print the only integer -1. In case of no roots print the only integer 0. In other cases print the number of root on the first line and the roots on the following lines in the ascending order. Print roots with at least 5 digits after the decimal point. | [
"1 -5 6\n"
] | [
"2\n2.0000000000\n3.0000000000"
] | none | 1,000 | [
{
"input": "1 -5 6",
"output": "2\n2.0000000000\n3.0000000000"
},
{
"input": "1 1 1",
"output": "0"
},
{
"input": "1 2 1",
"output": "1\n-1.0000000000"
},
{
"input": "0 0 0",
"output": "-1"
},
{
"input": "0 -2 1",
"output": "1\n0.5000000000"
},
{
"inpu... | 1,666,677,856 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 31 | 0 | import random as r
######.....FUNCTION TO RETURN WARMER OR COLDER.....######
import sys
import time
counter=1
def find(z,n):
global counter
global Prev_diff
counter+=1
if n==z: return 'BINGO'
elif abs(z-n)>=abs(Prev_diff):
Prev_diff=abs(z - n)
Prev_diff=Prev_diff
return 'COLD'
elif abs(z-n)<abs(Prev_diff):
Prev_diff=abs(z - n)
Prev_diff=Prev_diff
return 'WARM'
######.....FUNCTION TO GUESS NUMBER.....######
n=1000000
guessnumber=5000
Min=0
Max=n
previous1=0
previous2=0
current=(Min+Max)//2
print(current)
print('First')
if guessnumber==current:
print("Bingo")
sys.exit()
Prev_diff=abs(guessnumber-current)
while True:
#time.sleep(.001)
previous2=previous1
previous1=current
current=(current+Max)//2
y=find(guessnumber,current)
if y=='BINGO':
print("current", current)
print("Number of steps",counter)
print('BINGO')
break
if current==Max or current==Min:
previous2=previous1
privious1=current
current=(Min+Max)//2
############# added
y = find(guessnumber, current)
if y == 'BINGO':
print("current", current)
print("Number of steps", counter)
print('BINGO')
break
else:
if y=='WARM':
print("current", current)
print('WARM')
Min=previous1
else:
print("current", current)
print('COLD')
Max=current | Title: Equation
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
You are given an equation:
Your task is to find the number of distinct roots of the equation and print all of them in ascending order.
Input Specification:
The first line contains three integer numbers *A*,<=*B* and *C* (<=-<=105<=≤<=*A*,<=*B*,<=*C*<=≤<=105). Any coefficient may be equal to 0.
Output Specification:
In case of infinite root count print the only integer -1. In case of no roots print the only integer 0. In other cases print the number of root on the first line and the roots on the following lines in the ascending order. Print roots with at least 5 digits after the decimal point.
Demo Input:
['1 -5 6\n']
Demo Output:
['2\n2.0000000000\n3.0000000000']
Note:
none | ```python
import random as r
######.....FUNCTION TO RETURN WARMER OR COLDER.....######
import sys
import time
counter=1
def find(z,n):
global counter
global Prev_diff
counter+=1
if n==z: return 'BINGO'
elif abs(z-n)>=abs(Prev_diff):
Prev_diff=abs(z - n)
Prev_diff=Prev_diff
return 'COLD'
elif abs(z-n)<abs(Prev_diff):
Prev_diff=abs(z - n)
Prev_diff=Prev_diff
return 'WARM'
######.....FUNCTION TO GUESS NUMBER.....######
n=1000000
guessnumber=5000
Min=0
Max=n
previous1=0
previous2=0
current=(Min+Max)//2
print(current)
print('First')
if guessnumber==current:
print("Bingo")
sys.exit()
Prev_diff=abs(guessnumber-current)
while True:
#time.sleep(.001)
previous2=previous1
previous1=current
current=(current+Max)//2
y=find(guessnumber,current)
if y=='BINGO':
print("current", current)
print("Number of steps",counter)
print('BINGO')
break
if current==Max or current==Min:
previous2=previous1
privious1=current
current=(Min+Max)//2
############# added
y = find(guessnumber, current)
if y == 'BINGO':
print("current", current)
print("Number of steps", counter)
print('BINGO')
break
else:
if y=='WARM':
print("current", current)
print('WARM')
Min=previous1
else:
print("current", current)
print('COLD')
Max=current
``` | 0 |
16 | C | Monitor | PROGRAMMING | 1,800 | [
"binary search",
"number theory"
] | C. Monitor | 0 | 64 | Reca company makes monitors, the most popular of their models is AB999 with the screen size *a*<=×<=*b* centimeters. Because of some production peculiarities a screen parameters are integer numbers. Recently the screen sides ratio *x*:<=*y* became popular with users. That's why the company wants to reduce monitor AB999 size so that its screen sides ratio becomes *x*:<=*y*, at the same time they want its total area to be maximal of all possible variants. Your task is to find the screen parameters of the reduced size model, or find out that such a reduction can't be performed. | The first line of the input contains 4 integers — *a*, *b*, *x* and *y* (1<=≤<=*a*,<=*b*,<=*x*,<=*y*<=≤<=2·109). | If the answer exists, output 2 positive integers — screen parameters of the reduced size model. Output 0 0 otherwise. | [
"800 600 4 3\n",
"1920 1200 16 9\n",
"1 1 1 2\n"
] | [
"800 600\n",
"1920 1080\n",
"0 0\n"
] | none | 0 | [
{
"input": "800 600 4 3",
"output": "800 600"
},
{
"input": "1920 1200 16 9",
"output": "1920 1080"
},
{
"input": "1 1 1 2",
"output": "0 0"
},
{
"input": "1002105126 227379125 179460772 1295256518",
"output": "0 0"
},
{
"input": "625166755 843062051 1463070160 19... | 1,503,738,735 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 6 | 77 | 0 | a, b, x, y = map(int, input().split(' '))
if a < x or b < y:
i = 2
while i * i <= y:
if x % i == 0 and y % i == 0:
if x // i <= a and y // i <= b:
print(x // i, y // i, sep=' ')
exit()
i += 1
l = 0
r = 1e18
while r - l > 1:
mid = (r + l) // 2
if x * mid <= a and y * mid <= b:
l = mid
else:
r = mid
print(int(l * x), int(l * y), sep=' ')
| Title: Monitor
Time Limit: 0 seconds
Memory Limit: 64 megabytes
Problem Description:
Reca company makes monitors, the most popular of their models is AB999 with the screen size *a*<=×<=*b* centimeters. Because of some production peculiarities a screen parameters are integer numbers. Recently the screen sides ratio *x*:<=*y* became popular with users. That's why the company wants to reduce monitor AB999 size so that its screen sides ratio becomes *x*:<=*y*, at the same time they want its total area to be maximal of all possible variants. Your task is to find the screen parameters of the reduced size model, or find out that such a reduction can't be performed.
Input Specification:
The first line of the input contains 4 integers — *a*, *b*, *x* and *y* (1<=≤<=*a*,<=*b*,<=*x*,<=*y*<=≤<=2·109).
Output Specification:
If the answer exists, output 2 positive integers — screen parameters of the reduced size model. Output 0 0 otherwise.
Demo Input:
['800 600 4 3\n', '1920 1200 16 9\n', '1 1 1 2\n']
Demo Output:
['800 600\n', '1920 1080\n', '0 0\n']
Note:
none | ```python
a, b, x, y = map(int, input().split(' '))
if a < x or b < y:
i = 2
while i * i <= y:
if x % i == 0 and y % i == 0:
if x // i <= a and y // i <= b:
print(x // i, y // i, sep=' ')
exit()
i += 1
l = 0
r = 1e18
while r - l > 1:
mid = (r + l) // 2
if x * mid <= a and y * mid <= b:
l = mid
else:
r = mid
print(int(l * x), int(l * y), sep=' ')
``` | 0 |
975 | A | Aramic script | PROGRAMMING | 900 | [
"implementation",
"strings"
] | null | null | In Aramic language words can only represent objects.
Words in Aramic have special properties:
- A word is a root if it does not contain the same letter more than once. - A root and all its permutations represent the same object. - The root $x$ of a word $y$ is the word that contains all letters that appear in $y$ in a way that each letter appears once. For example, the root of "aaaa", "aa", "aaa" is "a", the root of "aabb", "bab", "baabb", "ab" is "ab". - Any word in Aramic represents the same object as its root.
You have an ancient script in Aramic. What is the number of different objects mentioned in the script? | The first line contains one integer $n$ ($1 \leq n \leq 10^3$) — the number of words in the script.
The second line contains $n$ words $s_1, s_2, \ldots, s_n$ — the script itself. The length of each string does not exceed $10^3$.
It is guaranteed that all characters of the strings are small latin letters. | Output one integer — the number of different objects mentioned in the given ancient Aramic script. | [
"5\na aa aaa ab abb\n",
"3\namer arem mrea\n"
] | [
"2",
"1"
] | In the first test, there are two objects mentioned. The roots that represent them are "a","ab".
In the second test, there is only one object, its root is "amer", the other strings are just permutations of "amer". | 500 | [
{
"input": "5\na aa aaa ab abb",
"output": "2"
},
{
"input": "3\namer arem mrea",
"output": "1"
},
{
"input": "10\nbda bbb cda dca dda dcb bcd dcb ada ddd",
"output": "6"
},
{
"input": "2\nfhjlqs aceginpr",
"output": "2"
},
{
"input": "2\nbcdfghimn efghijlmo",
... | 1,697,275,525 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 0 | 30 | 0 | def solve():
size = int(input())
words = input().split()
d = {}
for word in word:
x = tuple(sorted(set))
d[x] = d.get(tuple(sorted(set)), 0) + 1
print(len(d.values()))
if __name__ == "__main__":
solve() | Title: Aramic script
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
In Aramic language words can only represent objects.
Words in Aramic have special properties:
- A word is a root if it does not contain the same letter more than once. - A root and all its permutations represent the same object. - The root $x$ of a word $y$ is the word that contains all letters that appear in $y$ in a way that each letter appears once. For example, the root of "aaaa", "aa", "aaa" is "a", the root of "aabb", "bab", "baabb", "ab" is "ab". - Any word in Aramic represents the same object as its root.
You have an ancient script in Aramic. What is the number of different objects mentioned in the script?
Input Specification:
The first line contains one integer $n$ ($1 \leq n \leq 10^3$) — the number of words in the script.
The second line contains $n$ words $s_1, s_2, \ldots, s_n$ — the script itself. The length of each string does not exceed $10^3$.
It is guaranteed that all characters of the strings are small latin letters.
Output Specification:
Output one integer — the number of different objects mentioned in the given ancient Aramic script.
Demo Input:
['5\na aa aaa ab abb\n', '3\namer arem mrea\n']
Demo Output:
['2', '1']
Note:
In the first test, there are two objects mentioned. The roots that represent them are "a","ab".
In the second test, there is only one object, its root is "amer", the other strings are just permutations of "amer". | ```python
def solve():
size = int(input())
words = input().split()
d = {}
for word in word:
x = tuple(sorted(set))
d[x] = d.get(tuple(sorted(set)), 0) + 1
print(len(d.values()))
if __name__ == "__main__":
solve()
``` | -1 | |
595 | A | Vitaly and Night | PROGRAMMING | 800 | [
"constructive algorithms",
"implementation"
] | null | null | One day Vitaly was going home late at night and wondering: how many people aren't sleeping at that moment? To estimate, Vitaly decided to look which windows are lit in the house he was passing by at that moment.
Vitaly sees a building of *n* floors and 2·*m* windows on each floor. On each floor there are *m* flats numbered from 1 to *m*, and two consecutive windows correspond to each flat. If we number the windows from 1 to 2·*m* from left to right, then the *j*-th flat of the *i*-th floor has windows 2·*j*<=-<=1 and 2·*j* in the corresponding row of windows (as usual, floors are enumerated from the bottom). Vitaly thinks that people in the flat aren't sleeping at that moment if at least one of the windows corresponding to this flat has lights on.
Given the information about the windows of the given house, your task is to calculate the number of flats where, according to Vitaly, people aren't sleeping. | The first line of the input contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100) — the number of floors in the house and the number of flats on each floor respectively.
Next *n* lines describe the floors from top to bottom and contain 2·*m* characters each. If the *i*-th window of the given floor has lights on, then the *i*-th character of this line is '1', otherwise it is '0'. | Print a single integer — the number of flats that have lights on in at least one window, that is, the flats where, according to Vitaly, people aren't sleeping. | [
"2 2\n0 0 0 1\n1 0 1 1\n",
"1 3\n1 1 0 1 0 0\n"
] | [
"3\n",
"2\n"
] | In the first test case the house has two floors, two flats on each floor. That is, in total there are 4 flats. The light isn't on only on the second floor in the left flat. That is, in both rooms of the flat the light is off.
In the second test case the house has one floor and the first floor has three flats. The light is on in the leftmost flat (in both windows) and in the middle flat (in one window). In the right flat the light is off. | 500 | [
{
"input": "2 2\n0 0 0 1\n1 0 1 1",
"output": "3"
},
{
"input": "1 3\n1 1 0 1 0 0",
"output": "2"
},
{
"input": "3 3\n1 1 1 1 1 1\n1 1 0 1 1 0\n1 0 0 0 1 1",
"output": "8"
},
{
"input": "1 5\n1 0 1 1 1 0 1 1 1 1",
"output": "5"
},
{
"input": "1 100\n1 1 1 1 1 1 1 ... | 1,447,153,502 | 2,147,483,647 | Python 3 | OK | TESTS | 36 | 62 | 204,800 | data=input().strip().split()
mas=[]
col=0
for i in range(int(data[0])):
mas.append(input().strip().split())
for j in range(1,len(mas[i]),2):
if mas[i][j]=="1" or mas[i][j-1]=="1":
col+=1
print(col) | Title: Vitaly and Night
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One day Vitaly was going home late at night and wondering: how many people aren't sleeping at that moment? To estimate, Vitaly decided to look which windows are lit in the house he was passing by at that moment.
Vitaly sees a building of *n* floors and 2·*m* windows on each floor. On each floor there are *m* flats numbered from 1 to *m*, and two consecutive windows correspond to each flat. If we number the windows from 1 to 2·*m* from left to right, then the *j*-th flat of the *i*-th floor has windows 2·*j*<=-<=1 and 2·*j* in the corresponding row of windows (as usual, floors are enumerated from the bottom). Vitaly thinks that people in the flat aren't sleeping at that moment if at least one of the windows corresponding to this flat has lights on.
Given the information about the windows of the given house, your task is to calculate the number of flats where, according to Vitaly, people aren't sleeping.
Input Specification:
The first line of the input contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100) — the number of floors in the house and the number of flats on each floor respectively.
Next *n* lines describe the floors from top to bottom and contain 2·*m* characters each. If the *i*-th window of the given floor has lights on, then the *i*-th character of this line is '1', otherwise it is '0'.
Output Specification:
Print a single integer — the number of flats that have lights on in at least one window, that is, the flats where, according to Vitaly, people aren't sleeping.
Demo Input:
['2 2\n0 0 0 1\n1 0 1 1\n', '1 3\n1 1 0 1 0 0\n']
Demo Output:
['3\n', '2\n']
Note:
In the first test case the house has two floors, two flats on each floor. That is, in total there are 4 flats. The light isn't on only on the second floor in the left flat. That is, in both rooms of the flat the light is off.
In the second test case the house has one floor and the first floor has three flats. The light is on in the leftmost flat (in both windows) and in the middle flat (in one window). In the right flat the light is off. | ```python
data=input().strip().split()
mas=[]
col=0
for i in range(int(data[0])):
mas.append(input().strip().split())
for j in range(1,len(mas[i]),2):
if mas[i][j]=="1" or mas[i][j-1]=="1":
col+=1
print(col)
``` | 3 | |
318 | A | Even Odds | PROGRAMMING | 900 | [
"math"
] | null | null | Being a nonconformist, Volodya is displeased with the current state of things, particularly with the order of natural numbers (natural number is positive integer number). He is determined to rearrange them. But there are too many natural numbers, so Volodya decided to start with the first *n*. He writes down the following sequence of numbers: firstly all odd integers from 1 to *n* (in ascending order), then all even integers from 1 to *n* (also in ascending order). Help our hero to find out which number will stand at the position number *k*. | The only line of input contains integers *n* and *k* (1<=≤<=*k*<=≤<=*n*<=≤<=1012).
Please, do not use the %lld specifier to read or write 64-bit integers in C++. It is preferred to use the cin, cout streams or the %I64d specifier. | Print the number that will stand at the position number *k* after Volodya's manipulations. | [
"10 3\n",
"7 7\n"
] | [
"5",
"6"
] | In the first sample Volodya's sequence will look like this: {1, 3, 5, 7, 9, 2, 4, 6, 8, 10}. The third place in the sequence is therefore occupied by the number 5. | 500 | [
{
"input": "10 3",
"output": "5"
},
{
"input": "7 7",
"output": "6"
},
{
"input": "7 1",
"output": "1"
},
{
"input": "7 2",
"output": "3"
},
{
"input": "8 5",
"output": "2"
},
{
"input": "8 3",
"output": "5"
},
{
"input": "8 4",
"output... | 1,692,940,675 | 2,147,483,647 | Python 3 | OK | TESTS | 25 | 92 | 0 | from sys import stdin
def main():
n, k = [ int(x) for x in stdin.
readline().split(" ")]
miti= n- n//2
if ( k<=miti):
print(2*(k-1)+1)
else:
print(2*(k-miti))
main()
| Title: Even Odds
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Being a nonconformist, Volodya is displeased with the current state of things, particularly with the order of natural numbers (natural number is positive integer number). He is determined to rearrange them. But there are too many natural numbers, so Volodya decided to start with the first *n*. He writes down the following sequence of numbers: firstly all odd integers from 1 to *n* (in ascending order), then all even integers from 1 to *n* (also in ascending order). Help our hero to find out which number will stand at the position number *k*.
Input Specification:
The only line of input contains integers *n* and *k* (1<=≤<=*k*<=≤<=*n*<=≤<=1012).
Please, do not use the %lld specifier to read or write 64-bit integers in C++. It is preferred to use the cin, cout streams or the %I64d specifier.
Output Specification:
Print the number that will stand at the position number *k* after Volodya's manipulations.
Demo Input:
['10 3\n', '7 7\n']
Demo Output:
['5', '6']
Note:
In the first sample Volodya's sequence will look like this: {1, 3, 5, 7, 9, 2, 4, 6, 8, 10}. The third place in the sequence is therefore occupied by the number 5. | ```python
from sys import stdin
def main():
n, k = [ int(x) for x in stdin.
readline().split(" ")]
miti= n- n//2
if ( k<=miti):
print(2*(k-1)+1)
else:
print(2*(k-miti))
main()
``` | 3 | |
129 | A | Cookies | PROGRAMMING | 900 | [
"implementation"
] | null | null | Olga came to visit the twins Anna and Maria and saw that they have many cookies. The cookies are distributed into bags. As there are many cookies, Olga decided that it's no big deal if she steals a bag. However, she doesn't want the sisters to quarrel because of nothing when they divide the cookies. That's why Olga wants to steal a bag with cookies so that the number of cookies in the remaining bags was even, that is, so that Anna and Maria could evenly divide it into two (even 0 remaining cookies will do, just as any other even number). How many ways there are to steal exactly one cookie bag so that the total number of cookies in the remaining bags was even? | The first line contains the only integer *n* (1<=≤<=*n*<=≤<=100) — the number of cookie bags Anna and Maria have. The second line contains *n* integers *a**i* (1<=≤<=*a**i*<=≤<=100) — the number of cookies in the *i*-th bag. | Print in the only line the only number — the sought number of ways. If there are no such ways print 0. | [
"1\n1\n",
"10\n1 2 2 3 4 4 4 2 2 2\n",
"11\n2 2 2 2 2 2 2 2 2 2 99\n"
] | [
"1\n",
"8\n",
"1\n"
] | In the first sample Olga should take the only bag so that the twins ended up with the even number of cookies.
In the second sample Olga can take any of five bags with two cookies or any of three bags with four cookies — 5 + 3 = 8 ways in total.
In the third sample, no matter which bag with two cookies Olga chooses, the twins are left with 2 * 9 + 99 = 117 cookies. Thus, Olga has only one option: to take the bag with 99 cookies. | 500 | [
{
"input": "1\n1",
"output": "1"
},
{
"input": "10\n1 2 2 3 4 4 4 2 2 2",
"output": "8"
},
{
"input": "11\n2 2 2 2 2 2 2 2 2 2 99",
"output": "1"
},
{
"input": "2\n1 1",
"output": "0"
},
{
"input": "2\n2 2",
"output": "2"
},
{
"input": "2\n1 2",
"o... | 1,560,803,973 | 2,147,483,647 | Python 3 | OK | TESTS | 52 | 248 | 0 | n=int(input())
a=list(map(int,input().split()))
c=0
for i in range(len(a)):
if sum(a)-a[i]&1==0:
c+=1
print(c) | Title: Cookies
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Olga came to visit the twins Anna and Maria and saw that they have many cookies. The cookies are distributed into bags. As there are many cookies, Olga decided that it's no big deal if she steals a bag. However, she doesn't want the sisters to quarrel because of nothing when they divide the cookies. That's why Olga wants to steal a bag with cookies so that the number of cookies in the remaining bags was even, that is, so that Anna and Maria could evenly divide it into two (even 0 remaining cookies will do, just as any other even number). How many ways there are to steal exactly one cookie bag so that the total number of cookies in the remaining bags was even?
Input Specification:
The first line contains the only integer *n* (1<=≤<=*n*<=≤<=100) — the number of cookie bags Anna and Maria have. The second line contains *n* integers *a**i* (1<=≤<=*a**i*<=≤<=100) — the number of cookies in the *i*-th bag.
Output Specification:
Print in the only line the only number — the sought number of ways. If there are no such ways print 0.
Demo Input:
['1\n1\n', '10\n1 2 2 3 4 4 4 2 2 2\n', '11\n2 2 2 2 2 2 2 2 2 2 99\n']
Demo Output:
['1\n', '8\n', '1\n']
Note:
In the first sample Olga should take the only bag so that the twins ended up with the even number of cookies.
In the second sample Olga can take any of five bags with two cookies or any of three bags with four cookies — 5 + 3 = 8 ways in total.
In the third sample, no matter which bag with two cookies Olga chooses, the twins are left with 2 * 9 + 99 = 117 cookies. Thus, Olga has only one option: to take the bag with 99 cookies. | ```python
n=int(input())
a=list(map(int,input().split()))
c=0
for i in range(len(a)):
if sum(a)-a[i]&1==0:
c+=1
print(c)
``` | 3 | |
459 | E | Pashmak and Graph | PROGRAMMING | 1,900 | [
"dp",
"sortings"
] | null | null | Pashmak's homework is a problem about graphs. Although he always tries to do his homework completely, he can't solve this problem. As you know, he's really weak at graph theory; so try to help him in solving the problem.
You are given a weighted directed graph with *n* vertices and *m* edges. You need to find a path (perhaps, non-simple) with maximum number of edges, such that the weights of the edges increase along the path. In other words, each edge of the path must have strictly greater weight than the previous edge in the path.
Help Pashmak, print the number of edges in the required path. | The first line contains two integers *n*, *m* (2<=≤<=*n*<=≤<=3·105; 1<=≤<=*m*<=≤<=*min*(*n*·(*n*<=-<=1),<=3·105)). Then, *m* lines follows. The *i*-th line contains three space separated integers: *u**i*, *v**i*, *w**i* (1<=≤<=*u**i*,<=*v**i*<=≤<=*n*; 1<=≤<=*w**i*<=≤<=105) which indicates that there's a directed edge with weight *w**i* from vertex *u**i* to vertex *v**i*.
It's guaranteed that the graph doesn't contain self-loops and multiple edges. | Print a single integer — the answer to the problem. | [
"3 3\n1 2 1\n2 3 1\n3 1 1\n",
"3 3\n1 2 1\n2 3 2\n3 1 3\n",
"6 7\n1 2 1\n3 2 5\n2 4 2\n2 5 2\n2 6 9\n5 4 3\n4 3 4\n"
] | [
"1\n",
"3\n",
"6\n"
] | In the first sample the maximum trail can be any of this trails: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/1534088dd4d998a9bcc7e17dba96f7c213c54fc6.png" style="max-width: 100.0%;max-height: 100.0%;"/>.
In the second sample the maximum trail is <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/9b1d1f66686c43090329870c208942499764a73b.png" style="max-width: 100.0%;max-height: 100.0%;"/>.
In the third sample the maximum trail is <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/1db1cef44580d43663d6896f0190e5ccee9502c9.png" style="max-width: 100.0%;max-height: 100.0%;"/>. | 3,000 | [
{
"input": "3 3\n1 2 1\n2 3 1\n3 1 1",
"output": "1"
},
{
"input": "3 3\n1 2 1\n2 3 2\n3 1 3",
"output": "3"
},
{
"input": "6 7\n1 2 1\n3 2 5\n2 4 2\n2 5 2\n2 6 9\n5 4 3\n4 3 4",
"output": "6"
},
{
"input": "2 2\n1 2 1\n2 1 2",
"output": "2"
},
{
"input": "4 3\n1 ... | 1,669,461,117 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 46 | 0 | [n, m] = list(map(int, input().split()))
graph = [[] for i in range(m + 1)]
def minDistance(graph, dist, src, sptSet, pre, n):
minim = 1e7
min_index = src
for v in range(n):
if dist[v] != minim and sptSet[v] == False:
sptSet[v] = True
min_index = v
return min_index
def dijkstra(graph, n, start):
preNoode = start
dist = [1e7] * n
dist[start] = 0
paths = [0] * n
h = [False] * n
sptSet = [h.copy()] * n
pre = 0
u = start
for cout in range(n):
r = [False] * n
u = minDistance(graph, dist, preNoode, r, pre, n)
pre = graph[start][u]
for v in range(n):
if (graph[u][v] > 0
and dist[v] >= dist[u] + 1
and sptSet[u][v] == False
and graph[u][v] > pre):
dist[v] = dist[u] + 1
pre = graph[u][v]
sptSet[u][v] = True
paths[u] += 1
preNoode = v
return max(paths)
for i in range(m):
[u, v, w] = list(map(int, input().split()))
graph[w].append([v, u])
def findpath(graph, n):
maxim = 0
for j in range(n):
l = dijkstra(graph, n, j)
if l > maxim:
maxim = l
return maxim
dp = [1] * (n + 1)
for edge in graph:
adj = []
for e in edge:
v = e[0]
u = e[1]
adj.append([v, dp[u] + 1])
for [v, d] in adj:
if(dp[v] < d):
dp[v] = d
print(dp[n])
| Title: Pashmak and Graph
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Pashmak's homework is a problem about graphs. Although he always tries to do his homework completely, he can't solve this problem. As you know, he's really weak at graph theory; so try to help him in solving the problem.
You are given a weighted directed graph with *n* vertices and *m* edges. You need to find a path (perhaps, non-simple) with maximum number of edges, such that the weights of the edges increase along the path. In other words, each edge of the path must have strictly greater weight than the previous edge in the path.
Help Pashmak, print the number of edges in the required path.
Input Specification:
The first line contains two integers *n*, *m* (2<=≤<=*n*<=≤<=3·105; 1<=≤<=*m*<=≤<=*min*(*n*·(*n*<=-<=1),<=3·105)). Then, *m* lines follows. The *i*-th line contains three space separated integers: *u**i*, *v**i*, *w**i* (1<=≤<=*u**i*,<=*v**i*<=≤<=*n*; 1<=≤<=*w**i*<=≤<=105) which indicates that there's a directed edge with weight *w**i* from vertex *u**i* to vertex *v**i*.
It's guaranteed that the graph doesn't contain self-loops and multiple edges.
Output Specification:
Print a single integer — the answer to the problem.
Demo Input:
['3 3\n1 2 1\n2 3 1\n3 1 1\n', '3 3\n1 2 1\n2 3 2\n3 1 3\n', '6 7\n1 2 1\n3 2 5\n2 4 2\n2 5 2\n2 6 9\n5 4 3\n4 3 4\n']
Demo Output:
['1\n', '3\n', '6\n']
Note:
In the first sample the maximum trail can be any of this trails: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/1534088dd4d998a9bcc7e17dba96f7c213c54fc6.png" style="max-width: 100.0%;max-height: 100.0%;"/>.
In the second sample the maximum trail is <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/9b1d1f66686c43090329870c208942499764a73b.png" style="max-width: 100.0%;max-height: 100.0%;"/>.
In the third sample the maximum trail is <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/1db1cef44580d43663d6896f0190e5ccee9502c9.png" style="max-width: 100.0%;max-height: 100.0%;"/>. | ```python
[n, m] = list(map(int, input().split()))
graph = [[] for i in range(m + 1)]
def minDistance(graph, dist, src, sptSet, pre, n):
minim = 1e7
min_index = src
for v in range(n):
if dist[v] != minim and sptSet[v] == False:
sptSet[v] = True
min_index = v
return min_index
def dijkstra(graph, n, start):
preNoode = start
dist = [1e7] * n
dist[start] = 0
paths = [0] * n
h = [False] * n
sptSet = [h.copy()] * n
pre = 0
u = start
for cout in range(n):
r = [False] * n
u = minDistance(graph, dist, preNoode, r, pre, n)
pre = graph[start][u]
for v in range(n):
if (graph[u][v] > 0
and dist[v] >= dist[u] + 1
and sptSet[u][v] == False
and graph[u][v] > pre):
dist[v] = dist[u] + 1
pre = graph[u][v]
sptSet[u][v] = True
paths[u] += 1
preNoode = v
return max(paths)
for i in range(m):
[u, v, w] = list(map(int, input().split()))
graph[w].append([v, u])
def findpath(graph, n):
maxim = 0
for j in range(n):
l = dijkstra(graph, n, j)
if l > maxim:
maxim = l
return maxim
dp = [1] * (n + 1)
for edge in graph:
adj = []
for e in edge:
v = e[0]
u = e[1]
adj.append([v, dp[u] + 1])
for [v, d] in adj:
if(dp[v] < d):
dp[v] = d
print(dp[n])
``` | 0 | |
630 | A | Again Twenty Five! | PROGRAMMING | 800 | [
"number theory"
] | null | null | The HR manager was disappointed again. The last applicant failed the interview the same way as 24 previous ones. "Do I give such a hard task?" — the HR manager thought. "Just raise number 5 to the power of *n* and get last two digits of the number. Yes, of course, *n* can be rather big, and one cannot find the power using a calculator, but we need people who are able to think, not just follow the instructions."
Could you pass the interview in the machine vision company in IT City? | The only line of the input contains a single integer *n* (2<=≤<=*n*<=≤<=2·1018) — the power in which you need to raise number 5. | Output the last two digits of 5*n* without spaces between them. | [
"2\n"
] | [
"25"
] | none | 0 | [
{
"input": "2",
"output": "25"
},
{
"input": "7",
"output": "25"
},
{
"input": "1000000000000000000",
"output": "25"
},
{
"input": "2000000000000000000",
"output": "25"
},
{
"input": "987654321012345678",
"output": "25"
}
] | 1,688,629,586 | 2,147,483,647 | Python 3 | OK | TESTS | 5 | 31 | 0 | n = int(input())
if n % 4 == 0:
last_two_digits = 25
else:
last_two_digits = pow(5, n % 4)
last_two_digits = last_two_digits % 100
print(last_two_digits)
| Title: Again Twenty Five!
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The HR manager was disappointed again. The last applicant failed the interview the same way as 24 previous ones. "Do I give such a hard task?" — the HR manager thought. "Just raise number 5 to the power of *n* and get last two digits of the number. Yes, of course, *n* can be rather big, and one cannot find the power using a calculator, but we need people who are able to think, not just follow the instructions."
Could you pass the interview in the machine vision company in IT City?
Input Specification:
The only line of the input contains a single integer *n* (2<=≤<=*n*<=≤<=2·1018) — the power in which you need to raise number 5.
Output Specification:
Output the last two digits of 5*n* without spaces between them.
Demo Input:
['2\n']
Demo Output:
['25']
Note:
none | ```python
n = int(input())
if n % 4 == 0:
last_two_digits = 25
else:
last_two_digits = pow(5, n % 4)
last_two_digits = last_two_digits % 100
print(last_two_digits)
``` | 3 | |
260 | A | Adding Digits | PROGRAMMING | 1,400 | [
"implementation",
"math"
] | null | null | Vasya has got two number: *a* and *b*. However, Vasya finds number *a* too short. So he decided to repeat the operation of lengthening number *a* *n* times.
One operation of lengthening a number means adding exactly one digit to the number (in the decimal notation) to the right provided that the resulting number is divisible by Vasya's number *b*. If it is impossible to obtain the number which is divisible by *b*, then the lengthening operation cannot be performed.
Your task is to help Vasya and print the number he can get after applying the lengthening operation to number *a* *n* times. | The first line contains three integers: *a*,<=*b*,<=*n* (1<=≤<=*a*,<=*b*,<=*n*<=≤<=105). | In a single line print the integer without leading zeros, which Vasya can get when he applies the lengthening operations to number *a* *n* times. If no such number exists, then print number -1. If there are multiple possible answers, print any of them. | [
"5 4 5\n",
"12 11 1\n",
"260 150 10\n"
] | [
"524848\n",
"121\n",
"-1\n"
] | none | 500 | [
{
"input": "5 4 5",
"output": "524848"
},
{
"input": "12 11 1",
"output": "121"
},
{
"input": "260 150 10",
"output": "-1"
},
{
"input": "78843 5684 42717",
"output": "-1"
},
{
"input": "93248 91435 1133",
"output": "-1"
},
{
"input": "100000 10 64479"... | 1,603,789,459 | 2,147,483,647 | Python 3 | OK | TESTS | 25 | 108 | 204,800 | a,b,n=map(int,input().split())
c=str(a)
for (i) in range(10):
if int(c+str(i))%b==0:
c=c+str(i)
print(c + "0" * (n - 1))
exit()
print(-1)
| Title: Adding Digits
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya has got two number: *a* and *b*. However, Vasya finds number *a* too short. So he decided to repeat the operation of lengthening number *a* *n* times.
One operation of lengthening a number means adding exactly one digit to the number (in the decimal notation) to the right provided that the resulting number is divisible by Vasya's number *b*. If it is impossible to obtain the number which is divisible by *b*, then the lengthening operation cannot be performed.
Your task is to help Vasya and print the number he can get after applying the lengthening operation to number *a* *n* times.
Input Specification:
The first line contains three integers: *a*,<=*b*,<=*n* (1<=≤<=*a*,<=*b*,<=*n*<=≤<=105).
Output Specification:
In a single line print the integer without leading zeros, which Vasya can get when he applies the lengthening operations to number *a* *n* times. If no such number exists, then print number -1. If there are multiple possible answers, print any of them.
Demo Input:
['5 4 5\n', '12 11 1\n', '260 150 10\n']
Demo Output:
['524848\n', '121\n', '-1\n']
Note:
none | ```python
a,b,n=map(int,input().split())
c=str(a)
for (i) in range(10):
if int(c+str(i))%b==0:
c=c+str(i)
print(c + "0" * (n - 1))
exit()
print(-1)
``` | 3 | |
137 | B | Permutation | PROGRAMMING | 1,000 | [
"greedy"
] | null | null | "Hey, it's homework time" — thought Polycarpus and of course he started with his favourite subject, IT. Polycarpus managed to solve all tasks but for the last one in 20 minutes. However, as he failed to solve the last task after some considerable time, the boy asked you to help him.
The sequence of *n* integers is called a permutation if it contains all integers from 1 to *n* exactly once.
You are given an arbitrary sequence *a*1,<=*a*2,<=...,<=*a**n* containing *n* integers. Each integer is not less than 1 and not greater than 5000. Determine what minimum number of elements Polycarpus needs to change to get a permutation (he should not delete or add numbers). In a single change he can modify any single sequence element (i. e. replace it with another integer). | The first line of the input data contains an integer *n* (1<=≤<=*n*<=≤<=5000) which represents how many numbers are in the sequence. The second line contains a sequence of integers *a**i* (1<=≤<=*a**i*<=≤<=5000,<=1<=≤<=*i*<=≤<=*n*). | Print the only number — the minimum number of changes needed to get the permutation. | [
"3\n3 1 2\n",
"2\n2 2\n",
"5\n5 3 3 3 1\n"
] | [
"0\n",
"1\n",
"2\n"
] | The first sample contains the permutation, which is why no replacements are required.
In the second sample it is enough to replace the first element with the number 1 and that will make the sequence the needed permutation.
In the third sample we can replace the second element with number 4 and the fourth element with number 2. | 1,000 | [
{
"input": "3\n3 1 2",
"output": "0"
},
{
"input": "2\n2 2",
"output": "1"
},
{
"input": "5\n5 3 3 3 1",
"output": "2"
},
{
"input": "5\n6 6 6 6 6",
"output": "5"
},
{
"input": "10\n1 1 2 2 8 8 7 7 9 9",
"output": "5"
},
{
"input": "8\n9 8 7 6 5 4 3 2"... | 1,604,762,024 | 2,147,483,647 | Python 3 | TIME_LIMIT_EXCEEDED | TESTS | 18 | 2,000 | 307,200 | n=int(input())
s = list(map(int,input().rsplit()))
s.sort()
a=0
for i in range (1,n+1):
for j in range (0,n):
if s[j]==i:
break
if j==n-1:
a=a+1
print(a)
| Title: Permutation
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
"Hey, it's homework time" — thought Polycarpus and of course he started with his favourite subject, IT. Polycarpus managed to solve all tasks but for the last one in 20 minutes. However, as he failed to solve the last task after some considerable time, the boy asked you to help him.
The sequence of *n* integers is called a permutation if it contains all integers from 1 to *n* exactly once.
You are given an arbitrary sequence *a*1,<=*a*2,<=...,<=*a**n* containing *n* integers. Each integer is not less than 1 and not greater than 5000. Determine what minimum number of elements Polycarpus needs to change to get a permutation (he should not delete or add numbers). In a single change he can modify any single sequence element (i. e. replace it with another integer).
Input Specification:
The first line of the input data contains an integer *n* (1<=≤<=*n*<=≤<=5000) which represents how many numbers are in the sequence. The second line contains a sequence of integers *a**i* (1<=≤<=*a**i*<=≤<=5000,<=1<=≤<=*i*<=≤<=*n*).
Output Specification:
Print the only number — the minimum number of changes needed to get the permutation.
Demo Input:
['3\n3 1 2\n', '2\n2 2\n', '5\n5 3 3 3 1\n']
Demo Output:
['0\n', '1\n', '2\n']
Note:
The first sample contains the permutation, which is why no replacements are required.
In the second sample it is enough to replace the first element with the number 1 and that will make the sequence the needed permutation.
In the third sample we can replace the second element with number 4 and the fourth element with number 2. | ```python
n=int(input())
s = list(map(int,input().rsplit()))
s.sort()
a=0
for i in range (1,n+1):
for j in range (0,n):
if s[j]==i:
break
if j==n-1:
a=a+1
print(a)
``` | 0 | |
38 | A | Army | PROGRAMMING | 800 | [
"implementation"
] | A. Army | 2 | 256 | The Berland Armed Forces System consists of *n* ranks that are numbered using natural numbers from 1 to *n*, where 1 is the lowest rank and *n* is the highest rank.
One needs exactly *d**i* years to rise from rank *i* to rank *i*<=+<=1. Reaching a certain rank *i* having not reached all the previous *i*<=-<=1 ranks is impossible.
Vasya has just reached a new rank of *a*, but he dreams of holding the rank of *b*. Find for how many more years Vasya should serve in the army until he can finally realize his dream. | The first input line contains an integer *n* (2<=≤<=*n*<=≤<=100). The second line contains *n*<=-<=1 integers *d**i* (1<=≤<=*d**i*<=≤<=100). The third input line contains two integers *a* and *b* (1<=≤<=*a*<=<<=*b*<=≤<=*n*). The numbers on the lines are space-separated. | Print the single number which is the number of years that Vasya needs to rise from rank *a* to rank *b*. | [
"3\n5 6\n1 2\n",
"3\n5 6\n1 3\n"
] | [
"5\n",
"11\n"
] | none | 0 | [
{
"input": "3\n5 6\n1 2",
"output": "5"
},
{
"input": "3\n5 6\n1 3",
"output": "11"
},
{
"input": "2\n55\n1 2",
"output": "55"
},
{
"input": "3\n85 78\n1 3",
"output": "163"
},
{
"input": "4\n63 4 49\n2 3",
"output": "4"
},
{
"input": "5\n93 83 42 56\n... | 1,584,262,458 | 2,147,483,647 | Python 3 | OK | TESTS | 50 | 248 | 307,200 | n = int(input())
y = list(input().split())
y = [int(i) for i in y]
a, b = map(int, input().split())
count = 0
for i in range(b - a):
count += y[a - 1]
a += 1
print(count)
| Title: Army
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
The Berland Armed Forces System consists of *n* ranks that are numbered using natural numbers from 1 to *n*, where 1 is the lowest rank and *n* is the highest rank.
One needs exactly *d**i* years to rise from rank *i* to rank *i*<=+<=1. Reaching a certain rank *i* having not reached all the previous *i*<=-<=1 ranks is impossible.
Vasya has just reached a new rank of *a*, but he dreams of holding the rank of *b*. Find for how many more years Vasya should serve in the army until he can finally realize his dream.
Input Specification:
The first input line contains an integer *n* (2<=≤<=*n*<=≤<=100). The second line contains *n*<=-<=1 integers *d**i* (1<=≤<=*d**i*<=≤<=100). The third input line contains two integers *a* and *b* (1<=≤<=*a*<=<<=*b*<=≤<=*n*). The numbers on the lines are space-separated.
Output Specification:
Print the single number which is the number of years that Vasya needs to rise from rank *a* to rank *b*.
Demo Input:
['3\n5 6\n1 2\n', '3\n5 6\n1 3\n']
Demo Output:
['5\n', '11\n']
Note:
none | ```python
n = int(input())
y = list(input().split())
y = [int(i) for i in y]
a, b = map(int, input().split())
count = 0
for i in range(b - a):
count += y[a - 1]
a += 1
print(count)
``` | 3.937428 |
283 | C | Coin Troubles | PROGRAMMING | 2,100 | [
"dp"
] | null | null | In the Isle of Guernsey there are *n* different types of coins. For each *i* (1<=≤<=*i*<=≤<=*n*), coin of type *i* is worth *a**i* cents. It is possible that *a**i*<==<=*a**j* for some *i* and *j* (*i*<=≠<=*j*).
Bessie has some set of these coins totaling *t* cents. She tells Jessie *q* pairs of integers. For each *i* (1<=≤<=*i*<=≤<=*q*), the pair *b**i*,<=*c**i* tells Jessie that Bessie has a strictly greater number of coins of type *b**i* than coins of type *c**i*. It is known that all *b**i* are distinct and all *c**i* are distinct.
Help Jessie find the number of possible combinations of coins Bessie could have. Two combinations are considered different if there is some *i* (1<=≤<=*i*<=≤<=*n*), such that the number of coins Bessie has of type *i* is different in the two combinations. Since the answer can be very large, output it modulo 1000000007 (109<=+<=7).
If there are no possible combinations of coins totaling *t* cents that satisfy Bessie's conditions, output 0. | The first line contains three space-separated integers, *n*,<=*q* and *t* (1<=≤<=*n*<=≤<=300; 0<=≤<=*q*<=≤<=*n*; 1<=≤<=*t*<=≤<=105). The second line contains *n* space separated integers, *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=105). The next *q* lines each contain two distinct space-separated integers, *b**i* and *c**i* (1<=≤<=*b**i*,<=*c**i*<=≤<=*n*; *b**i*<=≠<=*c**i*).
It's guaranteed that all *b**i* are distinct and all *c**i* are distinct. | A single integer, the number of valid coin combinations that Bessie could have, modulo 1000000007 (109<=+<=7). | [
"4 2 17\n3 1 2 5\n4 2\n3 4\n",
"3 2 6\n3 1 1\n1 2\n2 3\n",
"3 2 10\n1 2 3\n1 2\n2 1\n"
] | [
"3\n",
"0\n",
"0\n"
] | For the first sample, the following 3 combinations give a total of 17 cents and satisfy the given conditions: {0 *of* *type* 1, 1 *of* *type* 2, 3 *of* *type* 3, 2 *of* *type* 4}, {0, 0, 6, 1}, {2, 0, 3, 1}.
No other combinations exist. Note that even though 4 occurs in both *b*<sub class="lower-index">*i*</sub> and *c*<sub class="lower-index">*i*</sub>, the problem conditions are still satisfied because all *b*<sub class="lower-index">*i*</sub> are distinct and all *c*<sub class="lower-index">*i*</sub> are distinct. | 1,500 | [
{
"input": "4 2 17\n3 1 2 5\n4 2\n3 4",
"output": "3"
},
{
"input": "3 2 6\n3 1 1\n1 2\n2 3",
"output": "0"
},
{
"input": "3 2 10\n1 2 3\n1 2\n2 1",
"output": "0"
},
{
"input": "10 0 97\n7 2 10 5 10 5 8 9 6 2",
"output": "823423"
},
{
"input": "10 2 11\n4 9 3 1 4 ... | 1,665,481,385 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 76 | 312 | 2,969,600 | '''
有n种价值为a[i]的硬币,某人拥有总值为t的硬币,已知q对数字(b,c)中,所有的b之间不同、
所有的c之间不同,其拥有的第b种币数量>第c种。求所有可能的方案数,并取模。
方案数为0的情况:数对表示的大小关系形成环(dfs检测环)
进行预处理之后使用完全背包
'''
R,P,G=lambda:map(int,input().split()),print,range;n,q,t=R();n+=1;a=[0]+[*R()]
# 图的预处理这块没看明白
g,d=[0]*n,[0]*n
for _ in G(q):u,v=R();g[u]=v;d[v]+=1
c=0
for u in G(1,n):
if d[u]==0:
s=0;v=u
while t>=0 and v>0:
c+=1;s+=a[v];a[v]=s
if g[v]>0:t-=s
v=g[v]
if t<0:break
if t<0 or c<n-1:exit(P(0))
f=[1]+[0]*t
for i in G(1,n):
for x in G(a[i],t+1):
f[x]+=f[x-a[i]];f[x]%=(10**9+7)
P(f[t]) | Title: Coin Troubles
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
In the Isle of Guernsey there are *n* different types of coins. For each *i* (1<=≤<=*i*<=≤<=*n*), coin of type *i* is worth *a**i* cents. It is possible that *a**i*<==<=*a**j* for some *i* and *j* (*i*<=≠<=*j*).
Bessie has some set of these coins totaling *t* cents. She tells Jessie *q* pairs of integers. For each *i* (1<=≤<=*i*<=≤<=*q*), the pair *b**i*,<=*c**i* tells Jessie that Bessie has a strictly greater number of coins of type *b**i* than coins of type *c**i*. It is known that all *b**i* are distinct and all *c**i* are distinct.
Help Jessie find the number of possible combinations of coins Bessie could have. Two combinations are considered different if there is some *i* (1<=≤<=*i*<=≤<=*n*), such that the number of coins Bessie has of type *i* is different in the two combinations. Since the answer can be very large, output it modulo 1000000007 (109<=+<=7).
If there are no possible combinations of coins totaling *t* cents that satisfy Bessie's conditions, output 0.
Input Specification:
The first line contains three space-separated integers, *n*,<=*q* and *t* (1<=≤<=*n*<=≤<=300; 0<=≤<=*q*<=≤<=*n*; 1<=≤<=*t*<=≤<=105). The second line contains *n* space separated integers, *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=105). The next *q* lines each contain two distinct space-separated integers, *b**i* and *c**i* (1<=≤<=*b**i*,<=*c**i*<=≤<=*n*; *b**i*<=≠<=*c**i*).
It's guaranteed that all *b**i* are distinct and all *c**i* are distinct.
Output Specification:
A single integer, the number of valid coin combinations that Bessie could have, modulo 1000000007 (109<=+<=7).
Demo Input:
['4 2 17\n3 1 2 5\n4 2\n3 4\n', '3 2 6\n3 1 1\n1 2\n2 3\n', '3 2 10\n1 2 3\n1 2\n2 1\n']
Demo Output:
['3\n', '0\n', '0\n']
Note:
For the first sample, the following 3 combinations give a total of 17 cents and satisfy the given conditions: {0 *of* *type* 1, 1 *of* *type* 2, 3 *of* *type* 3, 2 *of* *type* 4}, {0, 0, 6, 1}, {2, 0, 3, 1}.
No other combinations exist. Note that even though 4 occurs in both *b*<sub class="lower-index">*i*</sub> and *c*<sub class="lower-index">*i*</sub>, the problem conditions are still satisfied because all *b*<sub class="lower-index">*i*</sub> are distinct and all *c*<sub class="lower-index">*i*</sub> are distinct. | ```python
'''
有n种价值为a[i]的硬币,某人拥有总值为t的硬币,已知q对数字(b,c)中,所有的b之间不同、
所有的c之间不同,其拥有的第b种币数量>第c种。求所有可能的方案数,并取模。
方案数为0的情况:数对表示的大小关系形成环(dfs检测环)
进行预处理之后使用完全背包
'''
R,P,G=lambda:map(int,input().split()),print,range;n,q,t=R();n+=1;a=[0]+[*R()]
# 图的预处理这块没看明白
g,d=[0]*n,[0]*n
for _ in G(q):u,v=R();g[u]=v;d[v]+=1
c=0
for u in G(1,n):
if d[u]==0:
s=0;v=u
while t>=0 and v>0:
c+=1;s+=a[v];a[v]=s
if g[v]>0:t-=s
v=g[v]
if t<0:break
if t<0 or c<n-1:exit(P(0))
f=[1]+[0]*t
for i in G(1,n):
for x in G(a[i],t+1):
f[x]+=f[x-a[i]];f[x]%=(10**9+7)
P(f[t])
``` | 3 | |
389 | A | Fox and Number Game | PROGRAMMING | 1,000 | [
"greedy",
"math"
] | null | null | Fox Ciel is playing a game with numbers now.
Ciel has *n* positive integers: *x*1, *x*2, ..., *x**n*. She can do the following operation as many times as needed: select two different indexes *i* and *j* such that *x**i* > *x**j* hold, and then apply assignment *x**i* = *x**i* - *x**j*. The goal is to make the sum of all numbers as small as possible.
Please help Ciel to find this minimal sum. | The first line contains an integer *n* (2<=≤<=*n*<=≤<=100). Then the second line contains *n* integers: *x*1, *x*2, ..., *x**n* (1<=≤<=*x**i*<=≤<=100). | Output a single integer — the required minimal sum. | [
"2\n1 2\n",
"3\n2 4 6\n",
"2\n12 18\n",
"5\n45 12 27 30 18\n"
] | [
"2\n",
"6\n",
"12\n",
"15\n"
] | In the first example the optimal way is to do the assignment: *x*<sub class="lower-index">2</sub> = *x*<sub class="lower-index">2</sub> - *x*<sub class="lower-index">1</sub>.
In the second example the optimal sequence of operations is: *x*<sub class="lower-index">3</sub> = *x*<sub class="lower-index">3</sub> - *x*<sub class="lower-index">2</sub>, *x*<sub class="lower-index">2</sub> = *x*<sub class="lower-index">2</sub> - *x*<sub class="lower-index">1</sub>. | 500 | [
{
"input": "2\n1 2",
"output": "2"
},
{
"input": "3\n2 4 6",
"output": "6"
},
{
"input": "2\n12 18",
"output": "12"
},
{
"input": "5\n45 12 27 30 18",
"output": "15"
},
{
"input": "2\n1 1",
"output": "2"
},
{
"input": "2\n100 100",
"output": "200"
... | 1,595,859,682 | 2,147,483,647 | PyPy 3 | WRONG_ANSWER | TESTS | 4 | 109 | 20,172,800 |
n = int(input())
x = list(map(int, input().split()))
x = sorted(x)
y = []
for i in range(n-1):
y.append(x[-i-1]-x[-i-2])
y.append(x[0])
print(min(y)*n)
| Title: Fox and Number Game
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Fox Ciel is playing a game with numbers now.
Ciel has *n* positive integers: *x*1, *x*2, ..., *x**n*. She can do the following operation as many times as needed: select two different indexes *i* and *j* such that *x**i* > *x**j* hold, and then apply assignment *x**i* = *x**i* - *x**j*. The goal is to make the sum of all numbers as small as possible.
Please help Ciel to find this minimal sum.
Input Specification:
The first line contains an integer *n* (2<=≤<=*n*<=≤<=100). Then the second line contains *n* integers: *x*1, *x*2, ..., *x**n* (1<=≤<=*x**i*<=≤<=100).
Output Specification:
Output a single integer — the required minimal sum.
Demo Input:
['2\n1 2\n', '3\n2 4 6\n', '2\n12 18\n', '5\n45 12 27 30 18\n']
Demo Output:
['2\n', '6\n', '12\n', '15\n']
Note:
In the first example the optimal way is to do the assignment: *x*<sub class="lower-index">2</sub> = *x*<sub class="lower-index">2</sub> - *x*<sub class="lower-index">1</sub>.
In the second example the optimal sequence of operations is: *x*<sub class="lower-index">3</sub> = *x*<sub class="lower-index">3</sub> - *x*<sub class="lower-index">2</sub>, *x*<sub class="lower-index">2</sub> = *x*<sub class="lower-index">2</sub> - *x*<sub class="lower-index">1</sub>. | ```python
n = int(input())
x = list(map(int, input().split()))
x = sorted(x)
y = []
for i in range(n-1):
y.append(x[-i-1]-x[-i-2])
y.append(x[0])
print(min(y)*n)
``` | 0 | |
22 | A | Second Order Statistics | PROGRAMMING | 800 | [
"brute force"
] | A. Second Order Statistics | 2 | 256 | Once Bob needed to find the second order statistics of a sequence of integer numbers. Lets choose each number from the sequence exactly once and sort them. The value on the second position is the second order statistics of the given sequence. In other words it is the smallest element strictly greater than the minimum. Help Bob solve this problem. | The first input line contains integer *n* (1<=≤<=*n*<=≤<=100) — amount of numbers in the sequence. The second line contains *n* space-separated integer numbers — elements of the sequence. These numbers don't exceed 100 in absolute value. | If the given sequence has the second order statistics, output this order statistics, otherwise output NO. | [
"4\n1 2 2 -4\n",
"5\n1 2 3 1 1\n"
] | [
"1\n",
"2\n"
] | none | 0 | [
{
"input": "4\n1 2 2 -4",
"output": "1"
},
{
"input": "5\n1 2 3 1 1",
"output": "2"
},
{
"input": "1\n28",
"output": "NO"
},
{
"input": "2\n-28 12",
"output": "12"
},
{
"input": "3\n-83 40 -80",
"output": "-80"
},
{
"input": "8\n93 77 -92 26 21 -48 53 ... | 1,653,409,277 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 10 | 92 | 0 | n = int(input())
li1 = [int(x) for x in input().split()]
li2 = []
c = 0
if len(li1) > 1:
for i in li1:
if i not in li2:
li2.append(i)
li2.sort()
print(li2[1])
else:
print('NO')
| Title: Second Order Statistics
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Once Bob needed to find the second order statistics of a sequence of integer numbers. Lets choose each number from the sequence exactly once and sort them. The value on the second position is the second order statistics of the given sequence. In other words it is the smallest element strictly greater than the minimum. Help Bob solve this problem.
Input Specification:
The first input line contains integer *n* (1<=≤<=*n*<=≤<=100) — amount of numbers in the sequence. The second line contains *n* space-separated integer numbers — elements of the sequence. These numbers don't exceed 100 in absolute value.
Output Specification:
If the given sequence has the second order statistics, output this order statistics, otherwise output NO.
Demo Input:
['4\n1 2 2 -4\n', '5\n1 2 3 1 1\n']
Demo Output:
['1\n', '2\n']
Note:
none | ```python
n = int(input())
li1 = [int(x) for x in input().split()]
li2 = []
c = 0
if len(li1) > 1:
for i in li1:
if i not in li2:
li2.append(i)
li2.sort()
print(li2[1])
else:
print('NO')
``` | -1 |
567 | A | Lineland Mail | PROGRAMMING | 900 | [
"greedy",
"implementation"
] | null | null | All cities of Lineland are located on the *Ox* coordinate axis. Thus, each city is associated with its position *x**i* — a coordinate on the *Ox* axis. No two cities are located at a single point.
Lineland residents love to send letters to each other. A person may send a letter only if the recipient lives in another city (because if they live in the same city, then it is easier to drop in).
Strange but true, the cost of sending the letter is exactly equal to the distance between the sender's city and the recipient's city.
For each city calculate two values *min**i* and *max**i*, where *min**i* is the minimum cost of sending a letter from the *i*-th city to some other city, and *max**i* is the the maximum cost of sending a letter from the *i*-th city to some other city | The first line of the input contains integer *n* (2<=≤<=*n*<=≤<=105) — the number of cities in Lineland. The second line contains the sequence of *n* distinct integers *x*1,<=*x*2,<=...,<=*x**n* (<=-<=109<=≤<=*x**i*<=≤<=109), where *x**i* is the *x*-coordinate of the *i*-th city. All the *x**i*'s are distinct and follow in ascending order. | Print *n* lines, the *i*-th line must contain two integers *min**i*,<=*max**i*, separated by a space, where *min**i* is the minimum cost of sending a letter from the *i*-th city, and *max**i* is the maximum cost of sending a letter from the *i*-th city. | [
"4\n-5 -2 2 7\n",
"2\n-1 1\n"
] | [
"3 12\n3 9\n4 7\n5 12\n",
"2 2\n2 2\n"
] | none | 500 | [
{
"input": "4\n-5 -2 2 7",
"output": "3 12\n3 9\n4 7\n5 12"
},
{
"input": "2\n-1 1",
"output": "2 2\n2 2"
},
{
"input": "3\n-1 0 1",
"output": "1 2\n1 1\n1 2"
},
{
"input": "4\n-1 0 1 3",
"output": "1 4\n1 3\n1 2\n2 4"
},
{
"input": "3\n-1000000000 0 1000000000",
... | 1,679,777,613 | 2,147,483,647 | Python 3 | TIME_LIMIT_EXCEEDED | TESTS | 10 | 3,000 | 6,963,200 | n = int(input())
cities = [int(num) for num in input().split()]
for city in cities:
distances = []
for c in cities:
if c == city:
continue
if c > city:
distances.append(c - city)
else:
distances.append(city - c)
print(min(distances), max(distances))
| Title: Lineland Mail
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
All cities of Lineland are located on the *Ox* coordinate axis. Thus, each city is associated with its position *x**i* — a coordinate on the *Ox* axis. No two cities are located at a single point.
Lineland residents love to send letters to each other. A person may send a letter only if the recipient lives in another city (because if they live in the same city, then it is easier to drop in).
Strange but true, the cost of sending the letter is exactly equal to the distance between the sender's city and the recipient's city.
For each city calculate two values *min**i* and *max**i*, where *min**i* is the minimum cost of sending a letter from the *i*-th city to some other city, and *max**i* is the the maximum cost of sending a letter from the *i*-th city to some other city
Input Specification:
The first line of the input contains integer *n* (2<=≤<=*n*<=≤<=105) — the number of cities in Lineland. The second line contains the sequence of *n* distinct integers *x*1,<=*x*2,<=...,<=*x**n* (<=-<=109<=≤<=*x**i*<=≤<=109), where *x**i* is the *x*-coordinate of the *i*-th city. All the *x**i*'s are distinct and follow in ascending order.
Output Specification:
Print *n* lines, the *i*-th line must contain two integers *min**i*,<=*max**i*, separated by a space, where *min**i* is the minimum cost of sending a letter from the *i*-th city, and *max**i* is the maximum cost of sending a letter from the *i*-th city.
Demo Input:
['4\n-5 -2 2 7\n', '2\n-1 1\n']
Demo Output:
['3 12\n3 9\n4 7\n5 12\n', '2 2\n2 2\n']
Note:
none | ```python
n = int(input())
cities = [int(num) for num in input().split()]
for city in cities:
distances = []
for c in cities:
if c == city:
continue
if c > city:
distances.append(c - city)
else:
distances.append(city - c)
print(min(distances), max(distances))
``` | 0 | |
63 | A | Sinking Ship | PROGRAMMING | 900 | [
"implementation",
"sortings",
"strings"
] | A. Sinking Ship | 2 | 256 | The ship crashed into a reef and is sinking. Now the entire crew must be evacuated. All *n* crew members have already lined up in a row (for convenience let's label them all from left to right with positive integers from 1 to *n*) and await further instructions. However, one should evacuate the crew properly, in a strict order. Specifically:
The first crew members to leave the ship are rats. Then women and children (both groups have the same priority) leave the ship. After that all men are evacuated from the ship. The captain leaves the sinking ship last.
If we cannot determine exactly who should leave the ship first for any two members of the crew by the rules from the previous paragraph, then the one who stands to the left in the line leaves the ship first (or in other words, the one whose number in the line is less).
For each crew member we know his status as a crew member, and also his name. All crew members have different names. Determine the order in which to evacuate the crew. | The first line contains an integer *n*, which is the number of people in the crew (1<=≤<=*n*<=≤<=100). Then follow *n* lines. The *i*-th of those lines contains two words — the name of the crew member who is *i*-th in line, and his status on the ship. The words are separated by exactly one space. There are no other spaces in the line. The names consist of Latin letters, the first letter is uppercase, the rest are lowercase. The length of any name is from 1 to 10 characters. The status can have the following values: rat for a rat, woman for a woman, child for a child, man for a man, captain for the captain. The crew contains exactly one captain. | Print *n* lines. The *i*-th of them should contain the name of the crew member who must be the *i*-th one to leave the ship. | [
"6\nJack captain\nAlice woman\nCharlie man\nTeddy rat\nBob child\nJulia woman\n"
] | [
"Teddy\nAlice\nBob\nJulia\nCharlie\nJack\n"
] | none | 500 | [
{
"input": "6\nJack captain\nAlice woman\nCharlie man\nTeddy rat\nBob child\nJulia woman",
"output": "Teddy\nAlice\nBob\nJulia\nCharlie\nJack"
},
{
"input": "1\nA captain",
"output": "A"
},
{
"input": "1\nAbcdefjhij captain",
"output": "Abcdefjhij"
},
{
"input": "5\nA captain... | 1,580,761,017 | 2,147,483,647 | Python 3 | OK | TESTS | 26 | 216 | 307,200 | n = int(input())
in_list = []
cap = ""
rats = []
kd_w = []
m = []
for i in range(n):
curr = input()
mark = curr.split(" ")[1]
name = curr.split(" ")[0]
if mark == "rat":
rats.append(name)
elif mark == "woman" or mark == "child":
kd_w.append(name)
elif mark == "man":
m.append(name)
else:
cap = name
for i in rats:
print(i)
for i in kd_w:
print(i)
for i in m:
print(i)
print(cap)
| Title: Sinking Ship
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
The ship crashed into a reef and is sinking. Now the entire crew must be evacuated. All *n* crew members have already lined up in a row (for convenience let's label them all from left to right with positive integers from 1 to *n*) and await further instructions. However, one should evacuate the crew properly, in a strict order. Specifically:
The first crew members to leave the ship are rats. Then women and children (both groups have the same priority) leave the ship. After that all men are evacuated from the ship. The captain leaves the sinking ship last.
If we cannot determine exactly who should leave the ship first for any two members of the crew by the rules from the previous paragraph, then the one who stands to the left in the line leaves the ship first (or in other words, the one whose number in the line is less).
For each crew member we know his status as a crew member, and also his name. All crew members have different names. Determine the order in which to evacuate the crew.
Input Specification:
The first line contains an integer *n*, which is the number of people in the crew (1<=≤<=*n*<=≤<=100). Then follow *n* lines. The *i*-th of those lines contains two words — the name of the crew member who is *i*-th in line, and his status on the ship. The words are separated by exactly one space. There are no other spaces in the line. The names consist of Latin letters, the first letter is uppercase, the rest are lowercase. The length of any name is from 1 to 10 characters. The status can have the following values: rat for a rat, woman for a woman, child for a child, man for a man, captain for the captain. The crew contains exactly one captain.
Output Specification:
Print *n* lines. The *i*-th of them should contain the name of the crew member who must be the *i*-th one to leave the ship.
Demo Input:
['6\nJack captain\nAlice woman\nCharlie man\nTeddy rat\nBob child\nJulia woman\n']
Demo Output:
['Teddy\nAlice\nBob\nJulia\nCharlie\nJack\n']
Note:
none | ```python
n = int(input())
in_list = []
cap = ""
rats = []
kd_w = []
m = []
for i in range(n):
curr = input()
mark = curr.split(" ")[1]
name = curr.split(" ")[0]
if mark == "rat":
rats.append(name)
elif mark == "woman" or mark == "child":
kd_w.append(name)
elif mark == "man":
m.append(name)
else:
cap = name
for i in rats:
print(i)
for i in kd_w:
print(i)
for i in m:
print(i)
print(cap)
``` | 3.945428 |
723 | A | The New Year: Meeting Friends | PROGRAMMING | 800 | [
"implementation",
"math",
"sortings"
] | null | null | There are three friend living on the straight line *Ox* in Lineland. The first friend lives at the point *x*1, the second friend lives at the point *x*2, and the third friend lives at the point *x*3. They plan to celebrate the New Year together, so they need to meet at one point. What is the minimum total distance they have to travel in order to meet at some point and celebrate the New Year?
It's guaranteed that the optimal answer is always integer. | The first line of the input contains three distinct integers *x*1, *x*2 and *x*3 (1<=≤<=*x*1,<=*x*2,<=*x*3<=≤<=100) — the coordinates of the houses of the first, the second and the third friends respectively. | Print one integer — the minimum total distance the friends need to travel in order to meet together. | [
"7 1 4\n",
"30 20 10\n"
] | [
"6\n",
"20\n"
] | In the first sample, friends should meet at the point 4. Thus, the first friend has to travel the distance of 3 (from the point 7 to the point 4), the second friend also has to travel the distance of 3 (from the point 1 to the point 4), while the third friend should not go anywhere because he lives at the point 4. | 500 | [
{
"input": "7 1 4",
"output": "6"
},
{
"input": "30 20 10",
"output": "20"
},
{
"input": "1 4 100",
"output": "99"
},
{
"input": "100 1 91",
"output": "99"
},
{
"input": "1 45 100",
"output": "99"
},
{
"input": "1 2 3",
"output": "2"
},
{
"... | 1,690,001,418 | 2,147,483,647 | Python 3 | OK | TESTS | 48 | 46 | 0 | a = list(map(int, input().split()))
a.sort()
print(a[2]-a[0]) | Title: The New Year: Meeting Friends
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There are three friend living on the straight line *Ox* in Lineland. The first friend lives at the point *x*1, the second friend lives at the point *x*2, and the third friend lives at the point *x*3. They plan to celebrate the New Year together, so they need to meet at one point. What is the minimum total distance they have to travel in order to meet at some point and celebrate the New Year?
It's guaranteed that the optimal answer is always integer.
Input Specification:
The first line of the input contains three distinct integers *x*1, *x*2 and *x*3 (1<=≤<=*x*1,<=*x*2,<=*x*3<=≤<=100) — the coordinates of the houses of the first, the second and the third friends respectively.
Output Specification:
Print one integer — the minimum total distance the friends need to travel in order to meet together.
Demo Input:
['7 1 4\n', '30 20 10\n']
Demo Output:
['6\n', '20\n']
Note:
In the first sample, friends should meet at the point 4. Thus, the first friend has to travel the distance of 3 (from the point 7 to the point 4), the second friend also has to travel the distance of 3 (from the point 1 to the point 4), while the third friend should not go anywhere because he lives at the point 4. | ```python
a = list(map(int, input().split()))
a.sort()
print(a[2]-a[0])
``` | 3 | |
237 | A | Free Cash | PROGRAMMING | 1,000 | [
"implementation"
] | null | null | Valera runs a 24/7 fast food cafe. He magically learned that next day *n* people will visit his cafe. For each person we know the arrival time: the *i*-th person comes exactly at *h**i* hours *m**i* minutes. The cafe spends less than a minute to serve each client, but if a client comes in and sees that there is no free cash, than he doesn't want to wait and leaves the cafe immediately.
Valera is very greedy, so he wants to serve all *n* customers next day (and get more profit). However, for that he needs to ensure that at each moment of time the number of working cashes is no less than the number of clients in the cafe.
Help Valera count the minimum number of cashes to work at his cafe next day, so that they can serve all visitors. | The first line contains a single integer *n* (1<=≤<=*n*<=≤<=105), that is the number of cafe visitors.
Each of the following *n* lines has two space-separated integers *h**i* and *m**i* (0<=≤<=*h**i*<=≤<=23; 0<=≤<=*m**i*<=≤<=59), representing the time when the *i*-th person comes into the cafe.
Note that the time is given in the chronological order. All time is given within one 24-hour period. | Print a single integer — the minimum number of cashes, needed to serve all clients next day. | [
"4\n8 0\n8 10\n8 10\n8 45\n",
"3\n0 12\n10 11\n22 22\n"
] | [
"2\n",
"1\n"
] | In the first sample it is not enough one cash to serve all clients, because two visitors will come into cafe in 8:10. Therefore, if there will be one cash in cafe, then one customer will be served by it, and another one will not wait and will go away.
In the second sample all visitors will come in different times, so it will be enough one cash. | 500 | [
{
"input": "4\n8 0\n8 10\n8 10\n8 45",
"output": "2"
},
{
"input": "3\n0 12\n10 11\n22 22",
"output": "1"
},
{
"input": "5\n12 8\n15 27\n15 27\n16 2\n19 52",
"output": "2"
},
{
"input": "7\n5 6\n7 34\n7 34\n7 34\n12 29\n15 19\n20 23",
"output": "3"
},
{
"input": "... | 1,626,456,942 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 3 | 92 | 6,963,200 | d=[]
f=[]
for i in range(int(input())):
a,b=map(int,input().split())
d.append(a)
f.append(b)
g=0
for i in range(len(d)):
j=d[i]
l=f[i]
k=i
for i in range(k+1,len(d)):
if j==d[i] and l==f[i]:
g+=1
print(1+g) | Title: Free Cash
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Valera runs a 24/7 fast food cafe. He magically learned that next day *n* people will visit his cafe. For each person we know the arrival time: the *i*-th person comes exactly at *h**i* hours *m**i* minutes. The cafe spends less than a minute to serve each client, but if a client comes in and sees that there is no free cash, than he doesn't want to wait and leaves the cafe immediately.
Valera is very greedy, so he wants to serve all *n* customers next day (and get more profit). However, for that he needs to ensure that at each moment of time the number of working cashes is no less than the number of clients in the cafe.
Help Valera count the minimum number of cashes to work at his cafe next day, so that they can serve all visitors.
Input Specification:
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=105), that is the number of cafe visitors.
Each of the following *n* lines has two space-separated integers *h**i* and *m**i* (0<=≤<=*h**i*<=≤<=23; 0<=≤<=*m**i*<=≤<=59), representing the time when the *i*-th person comes into the cafe.
Note that the time is given in the chronological order. All time is given within one 24-hour period.
Output Specification:
Print a single integer — the minimum number of cashes, needed to serve all clients next day.
Demo Input:
['4\n8 0\n8 10\n8 10\n8 45\n', '3\n0 12\n10 11\n22 22\n']
Demo Output:
['2\n', '1\n']
Note:
In the first sample it is not enough one cash to serve all clients, because two visitors will come into cafe in 8:10. Therefore, if there will be one cash in cafe, then one customer will be served by it, and another one will not wait and will go away.
In the second sample all visitors will come in different times, so it will be enough one cash. | ```python
d=[]
f=[]
for i in range(int(input())):
a,b=map(int,input().split())
d.append(a)
f.append(b)
g=0
for i in range(len(d)):
j=d[i]
l=f[i]
k=i
for i in range(k+1,len(d)):
if j==d[i] and l==f[i]:
g+=1
print(1+g)
``` | 0 | |
69 | A | Young Physicist | PROGRAMMING | 1,000 | [
"implementation",
"math"
] | A. Young Physicist | 2 | 256 | A guy named Vasya attends the final grade of a high school. One day Vasya decided to watch a match of his favorite hockey team. And, as the boy loves hockey very much, even more than physics, he forgot to do the homework. Specifically, he forgot to complete his physics tasks. Next day the teacher got very angry at Vasya and decided to teach him a lesson. He gave the lazy student a seemingly easy task: You are given an idle body in space and the forces that affect it. The body can be considered as a material point with coordinates (0; 0; 0). Vasya had only to answer whether it is in equilibrium. "Piece of cake" — thought Vasya, we need only to check if the sum of all vectors is equal to 0. So, Vasya began to solve the problem. But later it turned out that there can be lots and lots of these forces, and Vasya can not cope without your help. Help him. Write a program that determines whether a body is idle or is moving by the given vectors of forces. | The first line contains a positive integer *n* (1<=≤<=*n*<=≤<=100), then follow *n* lines containing three integers each: the *x**i* coordinate, the *y**i* coordinate and the *z**i* coordinate of the force vector, applied to the body (<=-<=100<=≤<=*x**i*,<=*y**i*,<=*z**i*<=≤<=100). | Print the word "YES" if the body is in equilibrium, or the word "NO" if it is not. | [
"3\n4 1 7\n-2 4 -1\n1 -5 -3\n",
"3\n3 -1 7\n-5 2 -4\n2 -1 -3\n"
] | [
"NO",
"YES"
] | none | 500 | [
{
"input": "3\n4 1 7\n-2 4 -1\n1 -5 -3",
"output": "NO"
},
{
"input": "3\n3 -1 7\n-5 2 -4\n2 -1 -3",
"output": "YES"
},
{
"input": "10\n21 32 -46\n43 -35 21\n42 2 -50\n22 40 20\n-27 -9 38\n-4 1 1\n-40 6 -31\n-13 -2 34\n-21 34 -12\n-32 -29 41",
"output": "NO"
},
{
"input": "10... | 1,635,329,970 | 2,147,483,647 | PyPy 3 | OK | TESTS | 81 | 186 | 17,715,200 | n = int(input())
a, b, c = 0, 0, 0
for i in range(n):
d, e, f = map(int, input().split())
a += d
b += e
c += f
print('YES' if a == 0 and b == 0 and c == 0 else 'NO') | Title: Young Physicist
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
A guy named Vasya attends the final grade of a high school. One day Vasya decided to watch a match of his favorite hockey team. And, as the boy loves hockey very much, even more than physics, he forgot to do the homework. Specifically, he forgot to complete his physics tasks. Next day the teacher got very angry at Vasya and decided to teach him a lesson. He gave the lazy student a seemingly easy task: You are given an idle body in space and the forces that affect it. The body can be considered as a material point with coordinates (0; 0; 0). Vasya had only to answer whether it is in equilibrium. "Piece of cake" — thought Vasya, we need only to check if the sum of all vectors is equal to 0. So, Vasya began to solve the problem. But later it turned out that there can be lots and lots of these forces, and Vasya can not cope without your help. Help him. Write a program that determines whether a body is idle or is moving by the given vectors of forces.
Input Specification:
The first line contains a positive integer *n* (1<=≤<=*n*<=≤<=100), then follow *n* lines containing three integers each: the *x**i* coordinate, the *y**i* coordinate and the *z**i* coordinate of the force vector, applied to the body (<=-<=100<=≤<=*x**i*,<=*y**i*,<=*z**i*<=≤<=100).
Output Specification:
Print the word "YES" if the body is in equilibrium, or the word "NO" if it is not.
Demo Input:
['3\n4 1 7\n-2 4 -1\n1 -5 -3\n', '3\n3 -1 7\n-5 2 -4\n2 -1 -3\n']
Demo Output:
['NO', 'YES']
Note:
none | ```python
n = int(input())
a, b, c = 0, 0, 0
for i in range(n):
d, e, f = map(int, input().split())
a += d
b += e
c += f
print('YES' if a == 0 and b == 0 and c == 0 else 'NO')
``` | 3.920503 |
519 | B | A and B and Compilation Errors | PROGRAMMING | 1,100 | [
"data structures",
"implementation",
"sortings"
] | null | null | A and B are preparing themselves for programming contests.
B loves to debug his code. But before he runs the solution and starts debugging, he has to first compile the code.
Initially, the compiler displayed *n* compilation errors, each of them is represented as a positive integer. After some effort, B managed to fix some mistake and then another one mistake.
However, despite the fact that B is sure that he corrected the two errors, he can not understand exactly what compilation errors disappeared — the compiler of the language which B uses shows errors in the new order every time! B is sure that unlike many other programming languages, compilation errors for his programming language do not depend on each other, that is, if you correct one error, the set of other error does not change.
Can you help B find out exactly what two errors he corrected? | The first line of the input contains integer *n* (3<=≤<=*n*<=≤<=105) — the initial number of compilation errors.
The second line contains *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109) — the errors the compiler displayed for the first time.
The third line contains *n*<=-<=1 space-separated integers *b*1,<=*b*2,<=...,<=*b**n*<=-<=1 — the errors displayed at the second compilation. It is guaranteed that the sequence in the third line contains all numbers of the second string except for exactly one.
The fourth line contains *n*<=-<=2 space-separated integers *с*1,<=*с*2,<=...,<=*с**n*<=-<=2 — the errors displayed at the third compilation. It is guaranteed that the sequence in the fourth line contains all numbers of the third line except for exactly one. | Print two numbers on a single line: the numbers of the compilation errors that disappeared after B made the first and the second correction, respectively. | [
"5\n1 5 8 123 7\n123 7 5 1\n5 1 7\n",
"6\n1 4 3 3 5 7\n3 7 5 4 3\n4 3 7 5\n"
] | [
"8\n123\n",
"1\n3\n"
] | In the first test sample B first corrects the error number 8, then the error number 123.
In the second test sample B first corrects the error number 1, then the error number 3. Note that if there are multiple errors with the same number, B can correct only one of them in one step. | 1,000 | [
{
"input": "5\n1 5 8 123 7\n123 7 5 1\n5 1 7",
"output": "8\n123"
},
{
"input": "6\n1 4 3 3 5 7\n3 7 5 4 3\n4 3 7 5",
"output": "1\n3"
},
{
"input": "3\n1 2 3\n3 2\n2",
"output": "1\n3"
},
{
"input": "10\n460626451 802090732 277246428 661369649 388684428 784303821 376287098 6... | 1,665,969,935 | 2,147,483,647 | Python 3 | OK | TESTS | 33 | 170 | 9,523,200 | input()
soma_erros_1 = 0
for erro in list(map(int, input().split())):
soma_erros_1 += erro
soma_erros_2 = 0
for erro in list(map(int, input().split())):
soma_erros_2 += erro
soma_erros_3 = 0
for erro in list(map(int, input().split())):
soma_erros_3 += erro
erro_solucionado_1 = soma_erros_1 - soma_erros_2
erro_solucionado_2 = soma_erros_2 - soma_erros_3
print(erro_solucionado_1)
print(erro_solucionado_2)
| Title: A and B and Compilation Errors
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A and B are preparing themselves for programming contests.
B loves to debug his code. But before he runs the solution and starts debugging, he has to first compile the code.
Initially, the compiler displayed *n* compilation errors, each of them is represented as a positive integer. After some effort, B managed to fix some mistake and then another one mistake.
However, despite the fact that B is sure that he corrected the two errors, he can not understand exactly what compilation errors disappeared — the compiler of the language which B uses shows errors in the new order every time! B is sure that unlike many other programming languages, compilation errors for his programming language do not depend on each other, that is, if you correct one error, the set of other error does not change.
Can you help B find out exactly what two errors he corrected?
Input Specification:
The first line of the input contains integer *n* (3<=≤<=*n*<=≤<=105) — the initial number of compilation errors.
The second line contains *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109) — the errors the compiler displayed for the first time.
The third line contains *n*<=-<=1 space-separated integers *b*1,<=*b*2,<=...,<=*b**n*<=-<=1 — the errors displayed at the second compilation. It is guaranteed that the sequence in the third line contains all numbers of the second string except for exactly one.
The fourth line contains *n*<=-<=2 space-separated integers *с*1,<=*с*2,<=...,<=*с**n*<=-<=2 — the errors displayed at the third compilation. It is guaranteed that the sequence in the fourth line contains all numbers of the third line except for exactly one.
Output Specification:
Print two numbers on a single line: the numbers of the compilation errors that disappeared after B made the first and the second correction, respectively.
Demo Input:
['5\n1 5 8 123 7\n123 7 5 1\n5 1 7\n', '6\n1 4 3 3 5 7\n3 7 5 4 3\n4 3 7 5\n']
Demo Output:
['8\n123\n', '1\n3\n']
Note:
In the first test sample B first corrects the error number 8, then the error number 123.
In the second test sample B first corrects the error number 1, then the error number 3. Note that if there are multiple errors with the same number, B can correct only one of them in one step. | ```python
input()
soma_erros_1 = 0
for erro in list(map(int, input().split())):
soma_erros_1 += erro
soma_erros_2 = 0
for erro in list(map(int, input().split())):
soma_erros_2 += erro
soma_erros_3 = 0
for erro in list(map(int, input().split())):
soma_erros_3 += erro
erro_solucionado_1 = soma_erros_1 - soma_erros_2
erro_solucionado_2 = soma_erros_2 - soma_erros_3
print(erro_solucionado_1)
print(erro_solucionado_2)
``` | 3 | |
371 | C | Hamburgers | PROGRAMMING | 1,600 | [
"binary search",
"brute force"
] | null | null | Polycarpus loves hamburgers very much. He especially adores the hamburgers he makes with his own hands. Polycarpus thinks that there are only three decent ingredients to make hamburgers from: a bread, sausage and cheese. He writes down the recipe of his favorite "Le Hamburger de Polycarpus" as a string of letters 'B' (bread), 'S' (sausage) и 'C' (cheese). The ingredients in the recipe go from bottom to top, for example, recipe "ВSCBS" represents the hamburger where the ingredients go from bottom to top as bread, sausage, cheese, bread and sausage again.
Polycarpus has *n**b* pieces of bread, *n**s* pieces of sausage and *n**c* pieces of cheese in the kitchen. Besides, the shop nearby has all three ingredients, the prices are *p**b* rubles for a piece of bread, *p**s* for a piece of sausage and *p**c* for a piece of cheese.
Polycarpus has *r* rubles and he is ready to shop on them. What maximum number of hamburgers can he cook? You can assume that Polycarpus cannot break or slice any of the pieces of bread, sausage or cheese. Besides, the shop has an unlimited number of pieces of each ingredient. | The first line of the input contains a non-empty string that describes the recipe of "Le Hamburger de Polycarpus". The length of the string doesn't exceed 100, the string contains only letters 'B' (uppercase English B), 'S' (uppercase English S) and 'C' (uppercase English C).
The second line contains three integers *n**b*, *n**s*, *n**c* (1<=≤<=*n**b*,<=*n**s*,<=*n**c*<=≤<=100) — the number of the pieces of bread, sausage and cheese on Polycarpus' kitchen. The third line contains three integers *p**b*, *p**s*, *p**c* (1<=≤<=*p**b*,<=*p**s*,<=*p**c*<=≤<=100) — the price of one piece of bread, sausage and cheese in the shop. Finally, the fourth line contains integer *r* (1<=≤<=*r*<=≤<=1012) — the number of rubles Polycarpus has.
Please, do not write the %lld specifier to read or write 64-bit integers in С++. It is preferred to use the cin, cout streams or the %I64d specifier. | Print the maximum number of hamburgers Polycarpus can make. If he can't make any hamburger, print 0. | [
"BBBSSC\n6 4 1\n1 2 3\n4\n",
"BBC\n1 10 1\n1 10 1\n21\n",
"BSC\n1 1 1\n1 1 3\n1000000000000\n"
] | [
"2\n",
"7\n",
"200000000001\n"
] | none | 1,500 | [
{
"input": "BBBSSC\n6 4 1\n1 2 3\n4",
"output": "2"
},
{
"input": "BBC\n1 10 1\n1 10 1\n21",
"output": "7"
},
{
"input": "BSC\n1 1 1\n1 1 3\n1000000000000",
"output": "200000000001"
},
{
"input": "B\n1 1 1\n1 1 1\n381",
"output": "382"
},
{
"input": "BSC\n3 5 6\n7... | 1,675,221,905 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 31 | 62 | 1,433,600 | recipe = input()
bread = recipe.count("B")
sausage = recipe.count("S")
cheese = recipe.count("C")
nB, nS, nC = map(int, input().split())
nBP, nSP, nCP = map(int, input().split())
rubles = int(input())
burger = 0
total_price = bread * nBP + sausage * nSP + cheese * nCP
if bread == 0:
nB = 0
if sausage == 0:
nS = 0
if cheese == 0:
nC = 0
while nB - bread >= 0 and nS - sausage >= 0 and nC - cheese >= 0:
nB -= bread
nS -= sausage
nC -= cheese
burger += 1
if nB < 0 or nS < 0 or nC < 0:
burger -= 1
break
for i in range(rubles):
if nB == nS == nC == 0:
burger += rubles // total_price
break
if nB - bread < 0:
if rubles - nBP * abs(nB - bread) >= 0:
rubles -= nBP * abs(nB - bread)
nB += abs(nB - bread)
if nS - sausage < 0:
if rubles - nSP * abs(nS - sausage) >= 0:
rubles -= nSP * abs(nS - sausage)
nS += abs(nS - sausage)
if nC - cheese < 0:
if rubles - (nCP * abs(nC - cheese)) >= 0:
rubles -= nCP * abs(nC - cheese)
nC += abs(nC - cheese)
u = 0
while nB - bread >= 0 and nS - sausage >= 0 and nC - cheese >= 0 and u == 0:
nB -= bread
nS -= sausage
nC -= cheese
burger += 1
if nB < 0 or nS < 0 or nC < 0:
burger -= 1
u = 1
print(burger) | Title: Hamburgers
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Polycarpus loves hamburgers very much. He especially adores the hamburgers he makes with his own hands. Polycarpus thinks that there are only three decent ingredients to make hamburgers from: a bread, sausage and cheese. He writes down the recipe of his favorite "Le Hamburger de Polycarpus" as a string of letters 'B' (bread), 'S' (sausage) и 'C' (cheese). The ingredients in the recipe go from bottom to top, for example, recipe "ВSCBS" represents the hamburger where the ingredients go from bottom to top as bread, sausage, cheese, bread and sausage again.
Polycarpus has *n**b* pieces of bread, *n**s* pieces of sausage and *n**c* pieces of cheese in the kitchen. Besides, the shop nearby has all three ingredients, the prices are *p**b* rubles for a piece of bread, *p**s* for a piece of sausage and *p**c* for a piece of cheese.
Polycarpus has *r* rubles and he is ready to shop on them. What maximum number of hamburgers can he cook? You can assume that Polycarpus cannot break or slice any of the pieces of bread, sausage or cheese. Besides, the shop has an unlimited number of pieces of each ingredient.
Input Specification:
The first line of the input contains a non-empty string that describes the recipe of "Le Hamburger de Polycarpus". The length of the string doesn't exceed 100, the string contains only letters 'B' (uppercase English B), 'S' (uppercase English S) and 'C' (uppercase English C).
The second line contains three integers *n**b*, *n**s*, *n**c* (1<=≤<=*n**b*,<=*n**s*,<=*n**c*<=≤<=100) — the number of the pieces of bread, sausage and cheese on Polycarpus' kitchen. The third line contains three integers *p**b*, *p**s*, *p**c* (1<=≤<=*p**b*,<=*p**s*,<=*p**c*<=≤<=100) — the price of one piece of bread, sausage and cheese in the shop. Finally, the fourth line contains integer *r* (1<=≤<=*r*<=≤<=1012) — the number of rubles Polycarpus has.
Please, do not write the %lld specifier to read or write 64-bit integers in С++. It is preferred to use the cin, cout streams or the %I64d specifier.
Output Specification:
Print the maximum number of hamburgers Polycarpus can make. If he can't make any hamburger, print 0.
Demo Input:
['BBBSSC\n6 4 1\n1 2 3\n4\n', 'BBC\n1 10 1\n1 10 1\n21\n', 'BSC\n1 1 1\n1 1 3\n1000000000000\n']
Demo Output:
['2\n', '7\n', '200000000001\n']
Note:
none | ```python
recipe = input()
bread = recipe.count("B")
sausage = recipe.count("S")
cheese = recipe.count("C")
nB, nS, nC = map(int, input().split())
nBP, nSP, nCP = map(int, input().split())
rubles = int(input())
burger = 0
total_price = bread * nBP + sausage * nSP + cheese * nCP
if bread == 0:
nB = 0
if sausage == 0:
nS = 0
if cheese == 0:
nC = 0
while nB - bread >= 0 and nS - sausage >= 0 and nC - cheese >= 0:
nB -= bread
nS -= sausage
nC -= cheese
burger += 1
if nB < 0 or nS < 0 or nC < 0:
burger -= 1
break
for i in range(rubles):
if nB == nS == nC == 0:
burger += rubles // total_price
break
if nB - bread < 0:
if rubles - nBP * abs(nB - bread) >= 0:
rubles -= nBP * abs(nB - bread)
nB += abs(nB - bread)
if nS - sausage < 0:
if rubles - nSP * abs(nS - sausage) >= 0:
rubles -= nSP * abs(nS - sausage)
nS += abs(nS - sausage)
if nC - cheese < 0:
if rubles - (nCP * abs(nC - cheese)) >= 0:
rubles -= nCP * abs(nC - cheese)
nC += abs(nC - cheese)
u = 0
while nB - bread >= 0 and nS - sausage >= 0 and nC - cheese >= 0 and u == 0:
nB -= bread
nS -= sausage
nC -= cheese
burger += 1
if nB < 0 or nS < 0 or nC < 0:
burger -= 1
u = 1
print(burger)
``` | 3 | |
591 | B | Rebranding | PROGRAMMING | 1,200 | [
"implementation",
"strings"
] | null | null | The name of one small but proud corporation consists of *n* lowercase English letters. The Corporation has decided to try rebranding — an active marketing strategy, that includes a set of measures to change either the brand (both for the company and the goods it produces) or its components: the name, the logo, the slogan. They decided to start with the name.
For this purpose the corporation has consecutively hired *m* designers. Once a company hires the *i*-th designer, he immediately contributes to the creation of a new corporation name as follows: he takes the newest version of the name and replaces all the letters *x**i* by *y**i*, and all the letters *y**i* by *x**i*. This results in the new version. It is possible that some of these letters do no occur in the string. It may also happen that *x**i* coincides with *y**i*. The version of the name received after the work of the last designer becomes the new name of the corporation.
Manager Arkady has recently got a job in this company, but is already soaked in the spirit of teamwork and is very worried about the success of the rebranding. Naturally, he can't wait to find out what is the new name the Corporation will receive.
Satisfy Arkady's curiosity and tell him the final version of the name. | The first line of the input contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=200<=000) — the length of the initial name and the number of designers hired, respectively.
The second line consists of *n* lowercase English letters and represents the original name of the corporation.
Next *m* lines contain the descriptions of the designers' actions: the *i*-th of them contains two space-separated lowercase English letters *x**i* and *y**i*. | Print the new name of the corporation. | [
"6 1\npolice\np m\n",
"11 6\nabacabadaba\na b\nb c\na d\ne g\nf a\nb b\n"
] | [
"molice\n",
"cdcbcdcfcdc\n"
] | In the second sample the name of the corporation consecutively changes as follows:
<img align="middle" class="tex-formula" src="https://espresso.codeforces.com/c7648432f7138ca53234357d7e08d1d119166055.png" style="max-width: 100.0%;max-height: 100.0%;"/>
<img align="middle" class="tex-formula" src="https://espresso.codeforces.com/de89ad7bc7f27c46ec34f5e66ce0dc23bd5bc90a.png" style="max-width: 100.0%;max-height: 100.0%;"/>
<img align="middle" class="tex-formula" src="https://espresso.codeforces.com/812e653c8d7ff496e6a0f04c676423806751531e.png" style="max-width: 100.0%;max-height: 100.0%;"/>
<img align="middle" class="tex-formula" src="https://espresso.codeforces.com/19c564fcefb8dde36256240a8b877bb6a4792bfe.png" style="max-width: 100.0%;max-height: 100.0%;"/>
<img align="middle" class="tex-formula" src="https://espresso.codeforces.com/e1cafd93792430ad1a49e893e04715383bdae757.png" style="max-width: 100.0%;max-height: 100.0%;"/> | 1,000 | [
{
"input": "6 1\npolice\np m",
"output": "molice"
},
{
"input": "11 6\nabacabadaba\na b\nb c\na d\ne g\nf a\nb b",
"output": "cdcbcdcfcdc"
},
{
"input": "1 1\nf\nz h",
"output": "f"
},
{
"input": "1 1\na\na b",
"output": "b"
},
{
"input": "10 10\nlellelleel\ne l\n... | 1,485,728,450 | 2,147,483,647 | Python 3 | TIME_LIMIT_EXCEEDED | TESTS | 5 | 2,000 | 6,963,200 | import sys
size,swaps=map(int,sys.stdin.readline().split())
word=list(input())
alp=list('abcdefghijklmnopqrstuvwxyz')
for i in range(swaps):
a,b=map(str,sys.stdin.readline().split())
for j in range(26):
if alp[j]==a:
alp[j]=b
elif alp[j]==b:
alp[j]=a
for i in range(size):
print(alp[ord(word[i])-97],end='')
| Title: Rebranding
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The name of one small but proud corporation consists of *n* lowercase English letters. The Corporation has decided to try rebranding — an active marketing strategy, that includes a set of measures to change either the brand (both for the company and the goods it produces) or its components: the name, the logo, the slogan. They decided to start with the name.
For this purpose the corporation has consecutively hired *m* designers. Once a company hires the *i*-th designer, he immediately contributes to the creation of a new corporation name as follows: he takes the newest version of the name and replaces all the letters *x**i* by *y**i*, and all the letters *y**i* by *x**i*. This results in the new version. It is possible that some of these letters do no occur in the string. It may also happen that *x**i* coincides with *y**i*. The version of the name received after the work of the last designer becomes the new name of the corporation.
Manager Arkady has recently got a job in this company, but is already soaked in the spirit of teamwork and is very worried about the success of the rebranding. Naturally, he can't wait to find out what is the new name the Corporation will receive.
Satisfy Arkady's curiosity and tell him the final version of the name.
Input Specification:
The first line of the input contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=200<=000) — the length of the initial name and the number of designers hired, respectively.
The second line consists of *n* lowercase English letters and represents the original name of the corporation.
Next *m* lines contain the descriptions of the designers' actions: the *i*-th of them contains two space-separated lowercase English letters *x**i* and *y**i*.
Output Specification:
Print the new name of the corporation.
Demo Input:
['6 1\npolice\np m\n', '11 6\nabacabadaba\na b\nb c\na d\ne g\nf a\nb b\n']
Demo Output:
['molice\n', 'cdcbcdcfcdc\n']
Note:
In the second sample the name of the corporation consecutively changes as follows:
<img align="middle" class="tex-formula" src="https://espresso.codeforces.com/c7648432f7138ca53234357d7e08d1d119166055.png" style="max-width: 100.0%;max-height: 100.0%;"/>
<img align="middle" class="tex-formula" src="https://espresso.codeforces.com/de89ad7bc7f27c46ec34f5e66ce0dc23bd5bc90a.png" style="max-width: 100.0%;max-height: 100.0%;"/>
<img align="middle" class="tex-formula" src="https://espresso.codeforces.com/812e653c8d7ff496e6a0f04c676423806751531e.png" style="max-width: 100.0%;max-height: 100.0%;"/>
<img align="middle" class="tex-formula" src="https://espresso.codeforces.com/19c564fcefb8dde36256240a8b877bb6a4792bfe.png" style="max-width: 100.0%;max-height: 100.0%;"/>
<img align="middle" class="tex-formula" src="https://espresso.codeforces.com/e1cafd93792430ad1a49e893e04715383bdae757.png" style="max-width: 100.0%;max-height: 100.0%;"/> | ```python
import sys
size,swaps=map(int,sys.stdin.readline().split())
word=list(input())
alp=list('abcdefghijklmnopqrstuvwxyz')
for i in range(swaps):
a,b=map(str,sys.stdin.readline().split())
for j in range(26):
if alp[j]==a:
alp[j]=b
elif alp[j]==b:
alp[j]=a
for i in range(size):
print(alp[ord(word[i])-97],end='')
``` | 0 | |
66 | A | Petya and Java | PROGRAMMING | 1,300 | [
"implementation",
"strings"
] | A. Petya and Java | 2 | 256 | Little Petya has recently started attending a programming club. Naturally he is facing the problem of choosing a programming language. After long considerations he realized that Java is the best choice. The main argument in favor of choosing Java was that it has a very large integer data type, called BigInteger.
But having attended several classes of the club, Petya realized that not all tasks require using the BigInteger type. It turned out that in some tasks it is much easier to use small data types. That's why a question arises: "Which integer type to use if one wants to store a positive integer *n*?"
Petya knows only 5 integer types:
1) byte occupies 1 byte and allows you to store numbers from <=-<=128 to 127
2) short occupies 2 bytes and allows you to store numbers from <=-<=32768 to 32767
3) int occupies 4 bytes and allows you to store numbers from <=-<=2147483648 to 2147483647
4) long occupies 8 bytes and allows you to store numbers from <=-<=9223372036854775808 to 9223372036854775807
5) BigInteger can store any integer number, but at that it is not a primitive type, and operations with it are much slower.
For all the types given above the boundary values are included in the value range.
From this list, Petya wants to choose the smallest type that can store a positive integer *n*. Since BigInteger works much slower, Peter regards it last. Help him. | The first line contains a positive number *n*. It consists of no more than 100 digits and doesn't contain any leading zeros. The number *n* can't be represented as an empty string.
Please, do not use %lld specificator to read or write 64-bit integers in C++. It is preffered to use cout (also you may use %I64d). | Print the first type from the list "byte, short, int, long, BigInteger", that can store the natural number *n*, in accordance with the data given above. | [
"127\n",
"130\n",
"123456789101112131415161718192021222324\n"
] | [
"byte\n",
"short\n",
"BigInteger\n"
] | none | 500 | [
{
"input": "127",
"output": "byte"
},
{
"input": "130",
"output": "short"
},
{
"input": "123456789101112131415161718192021222324",
"output": "BigInteger"
},
{
"input": "6",
"output": "byte"
},
{
"input": "16",
"output": "byte"
},
{
"input": "126",
... | 1,630,202,026 | 2,147,483,647 | Python 3 | OK | TESTS | 90 | 154 | 6,758,400 | N=int(input())
if(-128<=N<=127):
print('byte')
elif(-32768<=N<=32767):
print('short')
elif(-2147483648<=N<=2147483647):
print('int')
elif((-(2**63))<=N<=(2**63-1)):
print('long')
else:
print('BigInteger') | Title: Petya and Java
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Little Petya has recently started attending a programming club. Naturally he is facing the problem of choosing a programming language. After long considerations he realized that Java is the best choice. The main argument in favor of choosing Java was that it has a very large integer data type, called BigInteger.
But having attended several classes of the club, Petya realized that not all tasks require using the BigInteger type. It turned out that in some tasks it is much easier to use small data types. That's why a question arises: "Which integer type to use if one wants to store a positive integer *n*?"
Petya knows only 5 integer types:
1) byte occupies 1 byte and allows you to store numbers from <=-<=128 to 127
2) short occupies 2 bytes and allows you to store numbers from <=-<=32768 to 32767
3) int occupies 4 bytes and allows you to store numbers from <=-<=2147483648 to 2147483647
4) long occupies 8 bytes and allows you to store numbers from <=-<=9223372036854775808 to 9223372036854775807
5) BigInteger can store any integer number, but at that it is not a primitive type, and operations with it are much slower.
For all the types given above the boundary values are included in the value range.
From this list, Petya wants to choose the smallest type that can store a positive integer *n*. Since BigInteger works much slower, Peter regards it last. Help him.
Input Specification:
The first line contains a positive number *n*. It consists of no more than 100 digits and doesn't contain any leading zeros. The number *n* can't be represented as an empty string.
Please, do not use %lld specificator to read or write 64-bit integers in C++. It is preffered to use cout (also you may use %I64d).
Output Specification:
Print the first type from the list "byte, short, int, long, BigInteger", that can store the natural number *n*, in accordance with the data given above.
Demo Input:
['127\n', '130\n', '123456789101112131415161718192021222324\n']
Demo Output:
['byte\n', 'short\n', 'BigInteger\n']
Note:
none | ```python
N=int(input())
if(-128<=N<=127):
print('byte')
elif(-32768<=N<=32767):
print('short')
elif(-2147483648<=N<=2147483647):
print('int')
elif((-(2**63))<=N<=(2**63-1)):
print('long')
else:
print('BigInteger')
``` | 3.948911 |
22 | A | Second Order Statistics | PROGRAMMING | 800 | [
"brute force"
] | A. Second Order Statistics | 2 | 256 | Once Bob needed to find the second order statistics of a sequence of integer numbers. Lets choose each number from the sequence exactly once and sort them. The value on the second position is the second order statistics of the given sequence. In other words it is the smallest element strictly greater than the minimum. Help Bob solve this problem. | The first input line contains integer *n* (1<=≤<=*n*<=≤<=100) — amount of numbers in the sequence. The second line contains *n* space-separated integer numbers — elements of the sequence. These numbers don't exceed 100 in absolute value. | If the given sequence has the second order statistics, output this order statistics, otherwise output NO. | [
"4\n1 2 2 -4\n",
"5\n1 2 3 1 1\n"
] | [
"1\n",
"2\n"
] | none | 0 | [
{
"input": "4\n1 2 2 -4",
"output": "1"
},
{
"input": "5\n1 2 3 1 1",
"output": "2"
},
{
"input": "1\n28",
"output": "NO"
},
{
"input": "2\n-28 12",
"output": "12"
},
{
"input": "3\n-83 40 -80",
"output": "-80"
},
{
"input": "8\n93 77 -92 26 21 -48 53 ... | 1,693,412,452 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 31 | 124 | 0 | n = int(input())
sequence = list(map(int, input().split()))
unique_sequence = sorted(set(sequence))
if len(unique_sequence) > 1:
print(unique_sequence[1])
else:
print("NO")
| Title: Second Order Statistics
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Once Bob needed to find the second order statistics of a sequence of integer numbers. Lets choose each number from the sequence exactly once and sort them. The value on the second position is the second order statistics of the given sequence. In other words it is the smallest element strictly greater than the minimum. Help Bob solve this problem.
Input Specification:
The first input line contains integer *n* (1<=≤<=*n*<=≤<=100) — amount of numbers in the sequence. The second line contains *n* space-separated integer numbers — elements of the sequence. These numbers don't exceed 100 in absolute value.
Output Specification:
If the given sequence has the second order statistics, output this order statistics, otherwise output NO.
Demo Input:
['4\n1 2 2 -4\n', '5\n1 2 3 1 1\n']
Demo Output:
['1\n', '2\n']
Note:
none | ```python
n = int(input())
sequence = list(map(int, input().split()))
unique_sequence = sorted(set(sequence))
if len(unique_sequence) > 1:
print(unique_sequence[1])
else:
print("NO")
``` | 3.969 |
928 | A | Login Verification | PROGRAMMING | 1,200 | [
"*special",
"strings"
] | null | null | When registering in a social network, users are allowed to create their own convenient login to make it easier to share contacts, print it on business cards, etc.
Login is an arbitrary sequence of lower and uppercase latin letters, digits and underline symbols («_»). However, in order to decrease the number of frauds and user-inattention related issues, it is prohibited to register a login if it is similar with an already existing login. More precisely, two logins *s* and *t* are considered similar if we can transform *s* to *t* via a sequence of operations of the following types:
- transform lowercase letters to uppercase and vice versa; - change letter «O» (uppercase latin letter) to digit «0» and vice versa; - change digit «1» (one) to any letter among «l» (lowercase latin «L»), «I» (uppercase latin «i») and vice versa, or change one of these letters to other.
For example, logins «Codeforces» and «codef0rces» as well as «OO0OOO00O0OOO0O00OOO0OO_lol» and «OO0OOO0O00OOO0O00OO0OOO_1oI» are considered similar whereas «Codeforces» and «Code_forces» are not.
You're given a list of existing logins with no two similar amonst and a newly created user login. Check whether this new login is similar with any of the existing ones. | The first line contains a non-empty string *s* consisting of lower and uppercase latin letters, digits and underline symbols («_») with length not exceeding 50 — the login itself.
The second line contains a single integer *n* (1<=≤<=*n*<=≤<=1<=000) — the number of existing logins.
The next *n* lines describe the existing logins, following the same constraints as the user login (refer to the first line of the input). It's guaranteed that no two existing logins are similar. | Print «Yes» (without quotes), if user can register via this login, i.e. none of the existing logins is similar with it.
Otherwise print «No» (without quotes). | [
"1_wat\n2\n2_wat\nwat_1\n",
"000\n3\n00\nooA\noOo\n",
"_i_\n3\n__i_\n_1_\nI\n",
"La0\n3\n2a0\nLa1\n1a0\n",
"abc\n1\naBc\n",
"0Lil\n2\nLIL0\n0Ril\n"
] | [
"Yes\n",
"No\n",
"No\n",
"No\n",
"No\n",
"Yes\n"
] | In the second sample case the user wants to create a login consisting of three zeros. It's impossible due to collision with the third among the existing.
In the third sample case the new login is similar with the second one. | 500 | [
{
"input": "1_wat\n2\n2_wat\nwat_1",
"output": "Yes"
},
{
"input": "000\n3\n00\nooA\noOo",
"output": "No"
},
{
"input": "_i_\n3\n__i_\n_1_\nI",
"output": "No"
},
{
"input": "La0\n3\n2a0\nLa1\n1a0",
"output": "No"
},
{
"input": "abc\n1\naBc",
"output": "No"
}... | 1,642,520,390 | 2,147,483,647 | Python 3 | OK | TESTS | 73 | 46 | 0 | def tq(q):
for i in range(len(q)):
if q[i]=="l" or q[i]=="i":
q[i]='1'
elif q[i]=="o":
q[i]='0'
p=[]
for i in q:
p+=[i]
return p
s=input()
s=s.lower()
s=list(s)
s=tq(s)
n=int(input())
while n>0:
s1=input()
s1=s1.lower()
s1=list(s1)
s1=tq(s1)
if s==s1:
print("No")
exit()
n-=1
print("Yes")
| Title: Login Verification
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
When registering in a social network, users are allowed to create their own convenient login to make it easier to share contacts, print it on business cards, etc.
Login is an arbitrary sequence of lower and uppercase latin letters, digits and underline symbols («_»). However, in order to decrease the number of frauds and user-inattention related issues, it is prohibited to register a login if it is similar with an already existing login. More precisely, two logins *s* and *t* are considered similar if we can transform *s* to *t* via a sequence of operations of the following types:
- transform lowercase letters to uppercase and vice versa; - change letter «O» (uppercase latin letter) to digit «0» and vice versa; - change digit «1» (one) to any letter among «l» (lowercase latin «L»), «I» (uppercase latin «i») and vice versa, or change one of these letters to other.
For example, logins «Codeforces» and «codef0rces» as well as «OO0OOO00O0OOO0O00OOO0OO_lol» and «OO0OOO0O00OOO0O00OO0OOO_1oI» are considered similar whereas «Codeforces» and «Code_forces» are not.
You're given a list of existing logins with no two similar amonst and a newly created user login. Check whether this new login is similar with any of the existing ones.
Input Specification:
The first line contains a non-empty string *s* consisting of lower and uppercase latin letters, digits and underline symbols («_») with length not exceeding 50 — the login itself.
The second line contains a single integer *n* (1<=≤<=*n*<=≤<=1<=000) — the number of existing logins.
The next *n* lines describe the existing logins, following the same constraints as the user login (refer to the first line of the input). It's guaranteed that no two existing logins are similar.
Output Specification:
Print «Yes» (without quotes), if user can register via this login, i.e. none of the existing logins is similar with it.
Otherwise print «No» (without quotes).
Demo Input:
['1_wat\n2\n2_wat\nwat_1\n', '000\n3\n00\nooA\noOo\n', '_i_\n3\n__i_\n_1_\nI\n', 'La0\n3\n2a0\nLa1\n1a0\n', 'abc\n1\naBc\n', '0Lil\n2\nLIL0\n0Ril\n']
Demo Output:
['Yes\n', 'No\n', 'No\n', 'No\n', 'No\n', 'Yes\n']
Note:
In the second sample case the user wants to create a login consisting of three zeros. It's impossible due to collision with the third among the existing.
In the third sample case the new login is similar with the second one. | ```python
def tq(q):
for i in range(len(q)):
if q[i]=="l" or q[i]=="i":
q[i]='1'
elif q[i]=="o":
q[i]='0'
p=[]
for i in q:
p+=[i]
return p
s=input()
s=s.lower()
s=list(s)
s=tq(s)
n=int(input())
while n>0:
s1=input()
s1=s1.lower()
s1=list(s1)
s1=tq(s1)
if s==s1:
print("No")
exit()
n-=1
print("Yes")
``` | 3 | |
9 | C | Hexadecimal's Numbers | PROGRAMMING | 1,200 | [
"brute force",
"implementation",
"math"
] | C. Hexadecimal's Numbers | 1 | 64 | One beautiful July morning a terrible thing happened in Mainframe: a mean virus Megabyte somehow got access to the memory of his not less mean sister Hexadecimal. He loaded there a huge amount of *n* different natural numbers from 1 to *n* to obtain total control over her energy.
But his plan failed. The reason for this was very simple: Hexadecimal didn't perceive any information, apart from numbers written in binary format. This means that if a number in a decimal representation contained characters apart from 0 and 1, it was not stored in the memory. Now Megabyte wants to know, how many numbers were loaded successfully. | Input data contains the only number *n* (1<=≤<=*n*<=≤<=109). | Output the only number — answer to the problem. | [
"10\n"
] | [
"2"
] | For *n* = 10 the answer includes numbers 1 and 10. | 0 | [
{
"input": "10",
"output": "2"
},
{
"input": "20",
"output": "3"
},
{
"input": "72",
"output": "3"
},
{
"input": "99",
"output": "3"
},
{
"input": "100",
"output": "4"
},
{
"input": "101",
"output": "5"
},
{
"input": "102",
"output": "5... | 1,547,711,555 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 1 | 186 | 0 | n = list(reversed(input()))
ans = 2 ** len(n) - 1
for i in range(len(n)):
if n[i] == "0":
ans -= 2 ** i
print(ans)
| Title: Hexadecimal's Numbers
Time Limit: 1 seconds
Memory Limit: 64 megabytes
Problem Description:
One beautiful July morning a terrible thing happened in Mainframe: a mean virus Megabyte somehow got access to the memory of his not less mean sister Hexadecimal. He loaded there a huge amount of *n* different natural numbers from 1 to *n* to obtain total control over her energy.
But his plan failed. The reason for this was very simple: Hexadecimal didn't perceive any information, apart from numbers written in binary format. This means that if a number in a decimal representation contained characters apart from 0 and 1, it was not stored in the memory. Now Megabyte wants to know, how many numbers were loaded successfully.
Input Specification:
Input data contains the only number *n* (1<=≤<=*n*<=≤<=109).
Output Specification:
Output the only number — answer to the problem.
Demo Input:
['10\n']
Demo Output:
['2']
Note:
For *n* = 10 the answer includes numbers 1 and 10. | ```python
n = list(reversed(input()))
ans = 2 ** len(n) - 1
for i in range(len(n)):
if n[i] == "0":
ans -= 2 ** i
print(ans)
``` | 0 |
719 | B | Anatoly and Cockroaches | PROGRAMMING | 1,400 | [
"greedy"
] | null | null | Anatoly lives in the university dorm as many other students do. As you know, cockroaches are also living there together with students. Cockroaches might be of two colors: black and red. There are *n* cockroaches living in Anatoly's room.
Anatoly just made all his cockroaches to form a single line. As he is a perfectionist, he would like the colors of cockroaches in the line to alternate. He has a can of black paint and a can of red paint. In one turn he can either swap any two cockroaches, or take any single cockroach and change it's color.
Help Anatoly find out the minimum number of turns he needs to make the colors of cockroaches in the line alternate. | The first line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=100<=000) — the number of cockroaches.
The second line contains a string of length *n*, consisting of characters 'b' and 'r' that denote black cockroach and red cockroach respectively. | Print one integer — the minimum number of moves Anatoly has to perform in order to make the colors of cockroaches in the line to alternate. | [
"5\nrbbrr\n",
"5\nbbbbb\n",
"3\nrbr\n"
] | [
"1\n",
"2\n",
"0\n"
] | In the first sample, Anatoly has to swap third and fourth cockroaches. He needs 1 turn to do this.
In the second sample, the optimum answer is to paint the second and the fourth cockroaches red. This requires 2 turns.
In the third sample, the colors of cockroaches in the line are alternating already, thus the answer is 0. | 1,000 | [
{
"input": "5\nrbbrr",
"output": "1"
},
{
"input": "5\nbbbbb",
"output": "2"
},
{
"input": "3\nrbr",
"output": "0"
},
{
"input": "13\nrbbbrbrrbrrbb",
"output": "3"
},
{
"input": "18\nrrrrrrrrrrrrrrrrrb",
"output": "8"
},
{
"input": "100\nbrbbbrrrbbrbrb... | 1,474,735,450 | 2,147,483,647 | Python 3 | OK | TESTS | 46 | 109 | 307,200 | #!/usr/bin/env python
#-*-coding:utf-8 -*-
input()
S=4*[0]
e=0
for c in input():
S[e|('r'!=c)<<1]+=1
e=not e
print(min(max(S[0],S[3]),max(S[1],S[2])))
| Title: Anatoly and Cockroaches
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Anatoly lives in the university dorm as many other students do. As you know, cockroaches are also living there together with students. Cockroaches might be of two colors: black and red. There are *n* cockroaches living in Anatoly's room.
Anatoly just made all his cockroaches to form a single line. As he is a perfectionist, he would like the colors of cockroaches in the line to alternate. He has a can of black paint and a can of red paint. In one turn he can either swap any two cockroaches, or take any single cockroach and change it's color.
Help Anatoly find out the minimum number of turns he needs to make the colors of cockroaches in the line alternate.
Input Specification:
The first line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=100<=000) — the number of cockroaches.
The second line contains a string of length *n*, consisting of characters 'b' and 'r' that denote black cockroach and red cockroach respectively.
Output Specification:
Print one integer — the minimum number of moves Anatoly has to perform in order to make the colors of cockroaches in the line to alternate.
Demo Input:
['5\nrbbrr\n', '5\nbbbbb\n', '3\nrbr\n']
Demo Output:
['1\n', '2\n', '0\n']
Note:
In the first sample, Anatoly has to swap third and fourth cockroaches. He needs 1 turn to do this.
In the second sample, the optimum answer is to paint the second and the fourth cockroaches red. This requires 2 turns.
In the third sample, the colors of cockroaches in the line are alternating already, thus the answer is 0. | ```python
#!/usr/bin/env python
#-*-coding:utf-8 -*-
input()
S=4*[0]
e=0
for c in input():
S[e|('r'!=c)<<1]+=1
e=not e
print(min(max(S[0],S[3]),max(S[1],S[2])))
``` | 3 | |
34 | A | Reconnaissance 2 | PROGRAMMING | 800 | [
"implementation"
] | A. Reconnaissance 2 | 2 | 256 | *n* soldiers stand in a circle. For each soldier his height *a**i* is known. A reconnaissance unit can be made of such two neighbouring soldiers, whose heights difference is minimal, i.e. |*a**i*<=-<=*a**j*| is minimal. So each of them will be less noticeable with the other. Output any pair of soldiers that can form a reconnaissance unit. | The first line contains integer *n* (2<=≤<=*n*<=≤<=100) — amount of soldiers. Then follow the heights of the soldiers in their order in the circle — *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=1000). The soldier heights are given in clockwise or counterclockwise direction. | Output two integers — indexes of neighbouring soldiers, who should form a reconnaissance unit. If there are many optimum solutions, output any of them. Remember, that the soldiers stand in a circle. | [
"5\n10 12 13 15 10\n",
"4\n10 20 30 40\n"
] | [
"5 1\n",
"1 2\n"
] | none | 500 | [
{
"input": "5\n10 12 13 15 10",
"output": "5 1"
},
{
"input": "4\n10 20 30 40",
"output": "1 2"
},
{
"input": "6\n744 359 230 586 944 442",
"output": "2 3"
},
{
"input": "5\n826 747 849 687 437",
"output": "1 2"
},
{
"input": "5\n999 999 993 969 999",
"output"... | 1,630,511,898 | 2,147,483,647 | Python 3 | OK | TESTS | 20 | 154 | 6,963,200 | n=int(input())
l=[int(x) for x in input().split()]
c=abs(l[0]-l[1])
ind=0
for i in range(1,n-1):
if abs(l[i]-l[i+1])<c:
c=abs(l[i]-l[i+1])
ind=i
if abs(l[0]-l[n-1])<c:
ind=n-1
print(ind+1,(ind+1)%n+1) | Title: Reconnaissance 2
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
*n* soldiers stand in a circle. For each soldier his height *a**i* is known. A reconnaissance unit can be made of such two neighbouring soldiers, whose heights difference is minimal, i.e. |*a**i*<=-<=*a**j*| is minimal. So each of them will be less noticeable with the other. Output any pair of soldiers that can form a reconnaissance unit.
Input Specification:
The first line contains integer *n* (2<=≤<=*n*<=≤<=100) — amount of soldiers. Then follow the heights of the soldiers in their order in the circle — *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=1000). The soldier heights are given in clockwise or counterclockwise direction.
Output Specification:
Output two integers — indexes of neighbouring soldiers, who should form a reconnaissance unit. If there are many optimum solutions, output any of them. Remember, that the soldiers stand in a circle.
Demo Input:
['5\n10 12 13 15 10\n', '4\n10 20 30 40\n']
Demo Output:
['5 1\n', '1 2\n']
Note:
none | ```python
n=int(input())
l=[int(x) for x in input().split()]
c=abs(l[0]-l[1])
ind=0
for i in range(1,n-1):
if abs(l[i]-l[i+1])<c:
c=abs(l[i]-l[i+1])
ind=i
if abs(l[0]-l[n-1])<c:
ind=n-1
print(ind+1,(ind+1)%n+1)
``` | 3.94853 |
854 | A | Fraction | PROGRAMMING | 800 | [
"brute force",
"constructive algorithms",
"math"
] | null | null | Petya is a big fan of mathematics, especially its part related to fractions. Recently he learned that a fraction is called proper iff its numerator is smaller than its denominator (*a*<=<<=*b*) and that the fraction is called irreducible if its numerator and its denominator are coprime (they do not have positive common divisors except 1).
During his free time, Petya thinks about proper irreducible fractions and converts them to decimals using the calculator. One day he mistakenly pressed addition button (<=+<=) instead of division button (÷) and got sum of numerator and denominator that was equal to *n* instead of the expected decimal notation.
Petya wanted to restore the original fraction, but soon he realized that it might not be done uniquely. That's why he decided to determine maximum possible proper irreducible fraction such that sum of its numerator and denominator equals *n*. Help Petya deal with this problem. | In the only line of input there is an integer *n* (3<=≤<=*n*<=≤<=1000), the sum of numerator and denominator of the fraction. | Output two space-separated positive integers *a* and *b*, numerator and denominator of the maximum possible proper irreducible fraction satisfying the given sum. | [
"3\n",
"4\n",
"12\n"
] | [
"1 2\n",
"1 3\n",
"5 7\n"
] | none | 500 | [
{
"input": "3",
"output": "1 2"
},
{
"input": "4",
"output": "1 3"
},
{
"input": "12",
"output": "5 7"
},
{
"input": "34",
"output": "15 19"
},
{
"input": "13",
"output": "6 7"
},
{
"input": "11",
"output": "5 6"
},
{
"input": "24",
"ou... | 1,597,395,828 | 2,147,483,647 | Python 3 | COMPILATION_ERROR | TESTS | 0 | 0 | 0 | a = 1
b =2
if (a==b)
print(a) | Title: Fraction
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Petya is a big fan of mathematics, especially its part related to fractions. Recently he learned that a fraction is called proper iff its numerator is smaller than its denominator (*a*<=<<=*b*) and that the fraction is called irreducible if its numerator and its denominator are coprime (they do not have positive common divisors except 1).
During his free time, Petya thinks about proper irreducible fractions and converts them to decimals using the calculator. One day he mistakenly pressed addition button (<=+<=) instead of division button (÷) and got sum of numerator and denominator that was equal to *n* instead of the expected decimal notation.
Petya wanted to restore the original fraction, but soon he realized that it might not be done uniquely. That's why he decided to determine maximum possible proper irreducible fraction such that sum of its numerator and denominator equals *n*. Help Petya deal with this problem.
Input Specification:
In the only line of input there is an integer *n* (3<=≤<=*n*<=≤<=1000), the sum of numerator and denominator of the fraction.
Output Specification:
Output two space-separated positive integers *a* and *b*, numerator and denominator of the maximum possible proper irreducible fraction satisfying the given sum.
Demo Input:
['3\n', '4\n', '12\n']
Demo Output:
['1 2\n', '1 3\n', '5 7\n']
Note:
none | ```python
a = 1
b =2
if (a==b)
print(a)
``` | -1 | |
137 | B | Permutation | PROGRAMMING | 1,000 | [
"greedy"
] | null | null | "Hey, it's homework time" — thought Polycarpus and of course he started with his favourite subject, IT. Polycarpus managed to solve all tasks but for the last one in 20 minutes. However, as he failed to solve the last task after some considerable time, the boy asked you to help him.
The sequence of *n* integers is called a permutation if it contains all integers from 1 to *n* exactly once.
You are given an arbitrary sequence *a*1,<=*a*2,<=...,<=*a**n* containing *n* integers. Each integer is not less than 1 and not greater than 5000. Determine what minimum number of elements Polycarpus needs to change to get a permutation (he should not delete or add numbers). In a single change he can modify any single sequence element (i. e. replace it with another integer). | The first line of the input data contains an integer *n* (1<=≤<=*n*<=≤<=5000) which represents how many numbers are in the sequence. The second line contains a sequence of integers *a**i* (1<=≤<=*a**i*<=≤<=5000,<=1<=≤<=*i*<=≤<=*n*). | Print the only number — the minimum number of changes needed to get the permutation. | [
"3\n3 1 2\n",
"2\n2 2\n",
"5\n5 3 3 3 1\n"
] | [
"0\n",
"1\n",
"2\n"
] | The first sample contains the permutation, which is why no replacements are required.
In the second sample it is enough to replace the first element with the number 1 and that will make the sequence the needed permutation.
In the third sample we can replace the second element with number 4 and the fourth element with number 2. | 1,000 | [
{
"input": "3\n3 1 2",
"output": "0"
},
{
"input": "2\n2 2",
"output": "1"
},
{
"input": "5\n5 3 3 3 1",
"output": "2"
},
{
"input": "5\n6 6 6 6 6",
"output": "5"
},
{
"input": "10\n1 1 2 2 8 8 7 7 9 9",
"output": "5"
},
{
"input": "8\n9 8 7 6 5 4 3 2"... | 1,420,166,527 | 2,147,483,647 | Python 3 | OK | TESTS | 48 | 154 | 307,200 | def main():
n = int(input())
i, res = 1, 0
for a in sorted(map(int, input().split())):
if i <= a <= n:
i = a + 1
else:
res += 1
print(res)
if __name__ == '__main__':
main() | Title: Permutation
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
"Hey, it's homework time" — thought Polycarpus and of course he started with his favourite subject, IT. Polycarpus managed to solve all tasks but for the last one in 20 minutes. However, as he failed to solve the last task after some considerable time, the boy asked you to help him.
The sequence of *n* integers is called a permutation if it contains all integers from 1 to *n* exactly once.
You are given an arbitrary sequence *a*1,<=*a*2,<=...,<=*a**n* containing *n* integers. Each integer is not less than 1 and not greater than 5000. Determine what minimum number of elements Polycarpus needs to change to get a permutation (he should not delete or add numbers). In a single change he can modify any single sequence element (i. e. replace it with another integer).
Input Specification:
The first line of the input data contains an integer *n* (1<=≤<=*n*<=≤<=5000) which represents how many numbers are in the sequence. The second line contains a sequence of integers *a**i* (1<=≤<=*a**i*<=≤<=5000,<=1<=≤<=*i*<=≤<=*n*).
Output Specification:
Print the only number — the minimum number of changes needed to get the permutation.
Demo Input:
['3\n3 1 2\n', '2\n2 2\n', '5\n5 3 3 3 1\n']
Demo Output:
['0\n', '1\n', '2\n']
Note:
The first sample contains the permutation, which is why no replacements are required.
In the second sample it is enough to replace the first element with the number 1 and that will make the sequence the needed permutation.
In the third sample we can replace the second element with number 4 and the fourth element with number 2. | ```python
def main():
n = int(input())
i, res = 1, 0
for a in sorted(map(int, input().split())):
if i <= a <= n:
i = a + 1
else:
res += 1
print(res)
if __name__ == '__main__':
main()
``` | 3 | |
133 | A | HQ9+ | PROGRAMMING | 900 | [
"implementation"
] | null | null | HQ9+ is a joke programming language which has only four one-character instructions:
- "H" prints "Hello, World!",- "Q" prints the source code of the program itself,- "9" prints the lyrics of "99 Bottles of Beer" song, - "+" increments the value stored in the internal accumulator.
Instructions "H" and "Q" are case-sensitive and must be uppercase. The characters of the program which are not instructions are ignored.
You are given a program written in HQ9+. You have to figure out whether executing this program will produce any output. | The input will consist of a single line *p* which will give a program in HQ9+. String *p* will contain between 1 and 100 characters, inclusive. ASCII-code of each character of *p* will be between 33 (exclamation mark) and 126 (tilde), inclusive. | Output "YES", if executing the program will produce any output, and "NO" otherwise. | [
"Hi!\n",
"Codeforces\n"
] | [
"YES\n",
"NO\n"
] | In the first case the program contains only one instruction — "H", which prints "Hello, World!".
In the second case none of the program characters are language instructions. | 500 | [
{
"input": "Hi!",
"output": "YES"
},
{
"input": "Codeforces",
"output": "NO"
},
{
"input": "a+b=c",
"output": "NO"
},
{
"input": "hq-lowercase",
"output": "NO"
},
{
"input": "Q",
"output": "YES"
},
{
"input": "9",
"output": "YES"
},
{
"inpu... | 1,685,819,060 | 2,147,483,647 | PyPy 3-64 | WRONG_ANSWER | TESTS | 2 | 92 | 0 | a = input()
ans = 0
for i in a:
if i == 'H' or i == 'Q' or i == '9' or i == '+':
print('YES')
break
else:
ans += 1
if ans == len(a):
print('NO') | Title: HQ9+
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
HQ9+ is a joke programming language which has only four one-character instructions:
- "H" prints "Hello, World!",- "Q" prints the source code of the program itself,- "9" prints the lyrics of "99 Bottles of Beer" song, - "+" increments the value stored in the internal accumulator.
Instructions "H" and "Q" are case-sensitive and must be uppercase. The characters of the program which are not instructions are ignored.
You are given a program written in HQ9+. You have to figure out whether executing this program will produce any output.
Input Specification:
The input will consist of a single line *p* which will give a program in HQ9+. String *p* will contain between 1 and 100 characters, inclusive. ASCII-code of each character of *p* will be between 33 (exclamation mark) and 126 (tilde), inclusive.
Output Specification:
Output "YES", if executing the program will produce any output, and "NO" otherwise.
Demo Input:
['Hi!\n', 'Codeforces\n']
Demo Output:
['YES\n', 'NO\n']
Note:
In the first case the program contains only one instruction — "H", which prints "Hello, World!".
In the second case none of the program characters are language instructions. | ```python
a = input()
ans = 0
for i in a:
if i == 'H' or i == 'Q' or i == '9' or i == '+':
print('YES')
break
else:
ans += 1
if ans == len(a):
print('NO')
``` | 0 | |
940 | B | Our Tanya is Crying Out Loud | PROGRAMMING | 1,400 | [
"dp",
"greedy"
] | null | null | Right now she actually isn't. But she will be, if you don't solve this problem.
You are given integers *n*, *k*, *A* and *B*. There is a number *x*, which is initially equal to *n*. You are allowed to perform two types of operations:
1. Subtract 1 from *x*. This operation costs you *A* coins. 1. Divide *x* by *k*. Can be performed only if *x* is divisible by *k*. This operation costs you *B* coins. | The first line contains a single integer *n* (1<=≤<=*n*<=≤<=2·109).
The second line contains a single integer *k* (1<=≤<=*k*<=≤<=2·109).
The third line contains a single integer *A* (1<=≤<=*A*<=≤<=2·109).
The fourth line contains a single integer *B* (1<=≤<=*B*<=≤<=2·109). | Output a single integer — the minimum amount of coins you have to pay to make *x* equal to 1. | [
"9\n2\n3\n1\n",
"5\n5\n2\n20\n",
"19\n3\n4\n2\n"
] | [
"6\n",
"8\n",
"12\n"
] | In the first testcase, the optimal strategy is as follows:
- Subtract 1 from *x* (9 → 8) paying 3 coins. - Divide *x* by 2 (8 → 4) paying 1 coin. - Divide *x* by 2 (4 → 2) paying 1 coin. - Divide *x* by 2 (2 → 1) paying 1 coin.
The total cost is 6 coins.
In the second test case the optimal strategy is to subtract 1 from *x* 4 times paying 8 coins in total. | 1,250 | [
{
"input": "9\n2\n3\n1",
"output": "6"
},
{
"input": "5\n5\n2\n20",
"output": "8"
},
{
"input": "19\n3\n4\n2",
"output": "12"
},
{
"input": "1845999546\n999435865\n1234234\n2323423",
"output": "1044857680578777"
},
{
"input": "1604353664\n1604353665\n9993432\n1",
... | 1,519,495,242 | 2,147,483,647 | Python 3 | TIME_LIMIT_EXCEEDED | TESTS | 6 | 1,000 | 5,632,000 | n=int(input())
k=int(input())
a=int(input())
b=int(input())
sum=0
x=n
if k==1:
print((n-1)*a)
else:
while x!=1:
if x<k:
sum+=(x-1)*a
x=1
elif x%k!=0:
sum+=(a*(x%k))
x=x-(x%k)
elif ((x-x/k)*a)>=b:
x//=k
sum+=b
elif (x-x/k)*a<b:
x-=1
sum+=a
print(sum)
| Title: Our Tanya is Crying Out Loud
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Right now she actually isn't. But she will be, if you don't solve this problem.
You are given integers *n*, *k*, *A* and *B*. There is a number *x*, which is initially equal to *n*. You are allowed to perform two types of operations:
1. Subtract 1 from *x*. This operation costs you *A* coins. 1. Divide *x* by *k*. Can be performed only if *x* is divisible by *k*. This operation costs you *B* coins.
Input Specification:
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=2·109).
The second line contains a single integer *k* (1<=≤<=*k*<=≤<=2·109).
The third line contains a single integer *A* (1<=≤<=*A*<=≤<=2·109).
The fourth line contains a single integer *B* (1<=≤<=*B*<=≤<=2·109).
Output Specification:
Output a single integer — the minimum amount of coins you have to pay to make *x* equal to 1.
Demo Input:
['9\n2\n3\n1\n', '5\n5\n2\n20\n', '19\n3\n4\n2\n']
Demo Output:
['6\n', '8\n', '12\n']
Note:
In the first testcase, the optimal strategy is as follows:
- Subtract 1 from *x* (9 → 8) paying 3 coins. - Divide *x* by 2 (8 → 4) paying 1 coin. - Divide *x* by 2 (4 → 2) paying 1 coin. - Divide *x* by 2 (2 → 1) paying 1 coin.
The total cost is 6 coins.
In the second test case the optimal strategy is to subtract 1 from *x* 4 times paying 8 coins in total. | ```python
n=int(input())
k=int(input())
a=int(input())
b=int(input())
sum=0
x=n
if k==1:
print((n-1)*a)
else:
while x!=1:
if x<k:
sum+=(x-1)*a
x=1
elif x%k!=0:
sum+=(a*(x%k))
x=x-(x%k)
elif ((x-x/k)*a)>=b:
x//=k
sum+=b
elif (x-x/k)*a<b:
x-=1
sum+=a
print(sum)
``` | 0 | |
893 | A | Chess For Three | PROGRAMMING | 900 | [
"implementation"
] | null | null | Alex, Bob and Carl will soon participate in a team chess tournament. Since they are all in the same team, they have decided to practise really hard before the tournament. But it's a bit difficult for them because chess is a game for two players, not three.
So they play with each other according to following rules:
- Alex and Bob play the first game, and Carl is spectating; - When the game ends, the one who lost the game becomes the spectator in the next game, and the one who was spectating plays against the winner.
Alex, Bob and Carl play in such a way that there are no draws.
Today they have played *n* games, and for each of these games they remember who was the winner. They decided to make up a log of games describing who won each game. But now they doubt if the information in the log is correct, and they want to know if the situation described in the log they made up was possible (that is, no game is won by someone who is spectating if Alex, Bob and Carl play according to the rules). Help them to check it! | The first line contains one integer *n* (1<=≤<=*n*<=≤<=100) — the number of games Alex, Bob and Carl played.
Then *n* lines follow, describing the game log. *i*-th line contains one integer *a**i* (1<=≤<=*a**i*<=≤<=3) which is equal to 1 if Alex won *i*-th game, to 2 if Bob won *i*-th game and 3 if Carl won *i*-th game. | Print YES if the situation described in the log was possible. Otherwise print NO. | [
"3\n1\n1\n2\n",
"2\n1\n2\n"
] | [
"YES\n",
"NO\n"
] | In the first example the possible situation is:
1. Alex wins, Carl starts playing instead of Bob; 1. Alex wins, Bob replaces Carl; 1. Bob wins.
The situation in the second example is impossible because Bob loses the first game, so he cannot win the second one. | 0 | [
{
"input": "3\n1\n1\n2",
"output": "YES"
},
{
"input": "2\n1\n2",
"output": "NO"
},
{
"input": "100\n2\n3\n1\n2\n3\n3\n3\n1\n1\n1\n1\n3\n3\n3\n3\n1\n2\n3\n3\n3\n3\n3\n3\n3\n1\n2\n2\n2\n3\n1\n1\n3\n3\n3\n3\n3\n3\n3\n3\n1\n2\n3\n3\n3\n1\n1\n1\n1\n3\n3\n3\n3\n1\n2\n3\n1\n2\n2\n2\n3\n3\n2\n1... | 1,623,836,998 | 2,147,483,647 | Python 3 | OK | TESTS | 37 | 62 | 0 | n = int(input())
a, b, c, x = True, True, False, []
d, s = {1: a, 2: b, 3: c}, [1, 2, 3]
for i in range(n):
x.append(int(input()))
for i in range(n):
if d[x[i]]:
b = list(s)
b.remove(x[i])
for j in b:
d[j] = not d[j]
else:
exit(print("NO"))
print("YES")
| Title: Chess For Three
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Alex, Bob and Carl will soon participate in a team chess tournament. Since they are all in the same team, they have decided to practise really hard before the tournament. But it's a bit difficult for them because chess is a game for two players, not three.
So they play with each other according to following rules:
- Alex and Bob play the first game, and Carl is spectating; - When the game ends, the one who lost the game becomes the spectator in the next game, and the one who was spectating plays against the winner.
Alex, Bob and Carl play in such a way that there are no draws.
Today they have played *n* games, and for each of these games they remember who was the winner. They decided to make up a log of games describing who won each game. But now they doubt if the information in the log is correct, and they want to know if the situation described in the log they made up was possible (that is, no game is won by someone who is spectating if Alex, Bob and Carl play according to the rules). Help them to check it!
Input Specification:
The first line contains one integer *n* (1<=≤<=*n*<=≤<=100) — the number of games Alex, Bob and Carl played.
Then *n* lines follow, describing the game log. *i*-th line contains one integer *a**i* (1<=≤<=*a**i*<=≤<=3) which is equal to 1 if Alex won *i*-th game, to 2 if Bob won *i*-th game and 3 if Carl won *i*-th game.
Output Specification:
Print YES if the situation described in the log was possible. Otherwise print NO.
Demo Input:
['3\n1\n1\n2\n', '2\n1\n2\n']
Demo Output:
['YES\n', 'NO\n']
Note:
In the first example the possible situation is:
1. Alex wins, Carl starts playing instead of Bob; 1. Alex wins, Bob replaces Carl; 1. Bob wins.
The situation in the second example is impossible because Bob loses the first game, so he cannot win the second one. | ```python
n = int(input())
a, b, c, x = True, True, False, []
d, s = {1: a, 2: b, 3: c}, [1, 2, 3]
for i in range(n):
x.append(int(input()))
for i in range(n):
if d[x[i]]:
b = list(s)
b.remove(x[i])
for j in b:
d[j] = not d[j]
else:
exit(print("NO"))
print("YES")
``` | 3 | |
998 | B | Cutting | PROGRAMMING | 1,200 | [
"dp",
"greedy",
"sortings"
] | null | null | There are a lot of things which could be cut — trees, paper, "the rope". In this problem you are going to cut a sequence of integers.
There is a sequence of integers, which contains the equal number of even and odd numbers. Given a limited budget, you need to make maximum possible number of cuts such that each resulting segment will have the same number of odd and even integers.
Cuts separate a sequence to continuous (contiguous) segments. You may think about each cut as a break between two adjacent elements in a sequence. So after cutting each element belongs to exactly one segment. Say, $[4, 1, 2, 3, 4, 5, 4, 4, 5, 5]$ $\to$ two cuts $\to$ $[4, 1 | 2, 3, 4, 5 | 4, 4, 5, 5]$. On each segment the number of even elements should be equal to the number of odd elements.
The cost of the cut between $x$ and $y$ numbers is $|x - y|$ bitcoins. Find the maximum possible number of cuts that can be made while spending no more than $B$ bitcoins. | First line of the input contains an integer $n$ ($2 \le n \le 100$) and an integer $B$ ($1 \le B \le 100$) — the number of elements in the sequence and the number of bitcoins you have.
Second line contains $n$ integers: $a_1$, $a_2$, ..., $a_n$ ($1 \le a_i \le 100$) — elements of the sequence, which contains the equal number of even and odd numbers | Print the maximum possible number of cuts which can be made while spending no more than $B$ bitcoins. | [
"6 4\n1 2 5 10 15 20\n",
"4 10\n1 3 2 4\n",
"6 100\n1 2 3 4 5 6\n"
] | [
"1\n",
"0\n",
"2\n"
] | In the first sample the optimal answer is to split sequence between $2$ and $5$. Price of this cut is equal to $3$ bitcoins.
In the second sample it is not possible to make even one cut even with unlimited number of bitcoins.
In the third sample the sequence should be cut between $2$ and $3$, and between $4$ and $5$. The total price of the cuts is $1 + 1 = 2$ bitcoins. | 1,000 | [
{
"input": "6 4\n1 2 5 10 15 20",
"output": "1"
},
{
"input": "4 10\n1 3 2 4",
"output": "0"
},
{
"input": "6 100\n1 2 3 4 5 6",
"output": "2"
},
{
"input": "2 100\n13 78",
"output": "0"
},
{
"input": "10 1\n56 56 98 2 11 64 97 41 95 53",
"output": "0"
},
... | 1,558,269,033 | 2,147,483,647 | Python 3 | OK | TESTS | 34 | 140 | 512,000 | # Lets goto the next level
# AIM Specialist at CF *__* asap
# template taken from chaudhary_19
# Remember you were also a novice when you started,
# hence never be rude to anyone who wants to learn something
# Never open a ranklist untill and unless you are done with solving problems, wastes 3/4 minuts
# Donot treat CP as a placement thing, love it and enjoy it, you will succeed for sure.
# Any doubts or want to have a talk, contact https://www.facebook.com/chaudhary.mayank
# ///==========Libraries, Constants and Functions=============///
import sys
from bisect import bisect_left,bisect_right,insort
from collections import deque,Counter
from math import gcd,sqrt,factorial,ceil,log10,log2,floor
from itertools import permutations
from heapq import heappush,heappop,heapify
inf = float("inf")
mod = 10**9+7
#sys.setrecursionlimit(10**9)
def factorial_p(n, p):
ans = 1
if n <= p // 2:
for i in range(1, n + 1):
ans = (ans * i) % p
else:
for i in range(1, p - n):
ans = (ans * i) % p
ans = pow(ans, p - 2, p)
if n % 2 == 0:
ans = p - ans
return ans
def nCr_p(n, r, p):
ans = 1
while (n != 0) or (r != 0):
a, b = n % p, r % p
if a < b:
return 0
ans = (ans * factorial_p(a, p) * pow(factorial_p(b, p), p - 2, p) * pow(factorial_p(a - b, p), p - 2, p)) % p
n //= p
r //= p
return ans
def prime_sieve(n):
"""returns a sieve of primes >= 5 and < n"""
flag = n % 6 == 2
sieve = bytearray((n // 3 + flag >> 3) + 1)
for i in range(1, int(n**0.5) // 3 + 1):
if not (sieve[i >> 3] >> (i & 7)) & 1:
k = (3 * i + 1) | 1
for j in range(k * k // 3, n // 3 + flag, 2 * k):
sieve[j >> 3] |= 1 << (j & 7)
for j in range(k * (k - 2 * (i & 1) + 4) // 3, n // 3 + flag, 2 * k):
sieve[j >> 3] |= 1 << (j & 7)
return sieve
def prime_list(n): #<----- You have to call me if you wanna get list of primes upto range n
"""returns a list of primes <= n"""
res = []
if n > 1:
res.append(2)
if n > 2:
res.append(3)
if n > 4:
sieve = prime_sieve(n + 1)
res.extend(3 * i + 1 | 1 for i in range(1, (n + 1) // 3 + (n % 6 == 1)) if not (sieve[i >> 3] >> (i & 7)) & 1)
return res
def is_prime(n):
"""returns True if n is prime else False"""
if n < 5 or n & 1 == 0 or n % 3 == 0:
return 2 <= n <= 3
s = ((n - 1) & (1 - n)).bit_length() - 1
d = n >> s
for a in [2, 325, 9375, 28178, 450775, 9780504, 1795265022]:
p = pow(a, d, n)
if p == 1 or p == n - 1 or a % n == 0:
continue
for _ in range(s):
p = (p * p) % n
if p == n - 1:
break
else:
return False
return True
def all_factors(n):
"""returns a sorted list of all distinct factors of n"""
small, large = [],[]
for i in range(1, int(n**0.5) + 1, 2 if n & 1 else 1):
if not n % i:
small.append(i)
large.append(n//i)
large.reverse()
small.extend(large)
return small
def get_array(): return list(map(int, sys.stdin.readline().strip().split()))
def get_ints(): return map(int, sys.stdin.readline().strip().split())
def input(): return sys.stdin.readline().strip()
# ///===========MAIN=============///
n,b=get_ints()
Arr=get_array()
even_suf=[0]*n
odd_suf=[0]*n
if Arr[0]&1:
odd_suf[0]=1
else:
even_suf[0]=1
for i in range(1,n):
if Arr[i]&1:
odd_suf[i]=odd_suf[i-1]+1
even_suf[i]=even_suf[i-1]
else:
even_suf[i]=even_suf[i-1]+1
odd_suf[i]=odd_suf[i-1]
result=[];flag=0
for i in range(1,n-1):
if odd_suf[i]==even_suf[i]:
result.append(abs(Arr[i]-Arr[i+1]))
flag=1
if flag==0:
print(0)
exit()
result.sort()
index=0
total=0
while(index<len(result) and total+result[index]<=b):
total+=result[index]
index+=1
print(index)
| Title: Cutting
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There are a lot of things which could be cut — trees, paper, "the rope". In this problem you are going to cut a sequence of integers.
There is a sequence of integers, which contains the equal number of even and odd numbers. Given a limited budget, you need to make maximum possible number of cuts such that each resulting segment will have the same number of odd and even integers.
Cuts separate a sequence to continuous (contiguous) segments. You may think about each cut as a break between two adjacent elements in a sequence. So after cutting each element belongs to exactly one segment. Say, $[4, 1, 2, 3, 4, 5, 4, 4, 5, 5]$ $\to$ two cuts $\to$ $[4, 1 | 2, 3, 4, 5 | 4, 4, 5, 5]$. On each segment the number of even elements should be equal to the number of odd elements.
The cost of the cut between $x$ and $y$ numbers is $|x - y|$ bitcoins. Find the maximum possible number of cuts that can be made while spending no more than $B$ bitcoins.
Input Specification:
First line of the input contains an integer $n$ ($2 \le n \le 100$) and an integer $B$ ($1 \le B \le 100$) — the number of elements in the sequence and the number of bitcoins you have.
Second line contains $n$ integers: $a_1$, $a_2$, ..., $a_n$ ($1 \le a_i \le 100$) — elements of the sequence, which contains the equal number of even and odd numbers
Output Specification:
Print the maximum possible number of cuts which can be made while spending no more than $B$ bitcoins.
Demo Input:
['6 4\n1 2 5 10 15 20\n', '4 10\n1 3 2 4\n', '6 100\n1 2 3 4 5 6\n']
Demo Output:
['1\n', '0\n', '2\n']
Note:
In the first sample the optimal answer is to split sequence between $2$ and $5$. Price of this cut is equal to $3$ bitcoins.
In the second sample it is not possible to make even one cut even with unlimited number of bitcoins.
In the third sample the sequence should be cut between $2$ and $3$, and between $4$ and $5$. The total price of the cuts is $1 + 1 = 2$ bitcoins. | ```python
# Lets goto the next level
# AIM Specialist at CF *__* asap
# template taken from chaudhary_19
# Remember you were also a novice when you started,
# hence never be rude to anyone who wants to learn something
# Never open a ranklist untill and unless you are done with solving problems, wastes 3/4 minuts
# Donot treat CP as a placement thing, love it and enjoy it, you will succeed for sure.
# Any doubts or want to have a talk, contact https://www.facebook.com/chaudhary.mayank
# ///==========Libraries, Constants and Functions=============///
import sys
from bisect import bisect_left,bisect_right,insort
from collections import deque,Counter
from math import gcd,sqrt,factorial,ceil,log10,log2,floor
from itertools import permutations
from heapq import heappush,heappop,heapify
inf = float("inf")
mod = 10**9+7
#sys.setrecursionlimit(10**9)
def factorial_p(n, p):
ans = 1
if n <= p // 2:
for i in range(1, n + 1):
ans = (ans * i) % p
else:
for i in range(1, p - n):
ans = (ans * i) % p
ans = pow(ans, p - 2, p)
if n % 2 == 0:
ans = p - ans
return ans
def nCr_p(n, r, p):
ans = 1
while (n != 0) or (r != 0):
a, b = n % p, r % p
if a < b:
return 0
ans = (ans * factorial_p(a, p) * pow(factorial_p(b, p), p - 2, p) * pow(factorial_p(a - b, p), p - 2, p)) % p
n //= p
r //= p
return ans
def prime_sieve(n):
"""returns a sieve of primes >= 5 and < n"""
flag = n % 6 == 2
sieve = bytearray((n // 3 + flag >> 3) + 1)
for i in range(1, int(n**0.5) // 3 + 1):
if not (sieve[i >> 3] >> (i & 7)) & 1:
k = (3 * i + 1) | 1
for j in range(k * k // 3, n // 3 + flag, 2 * k):
sieve[j >> 3] |= 1 << (j & 7)
for j in range(k * (k - 2 * (i & 1) + 4) // 3, n // 3 + flag, 2 * k):
sieve[j >> 3] |= 1 << (j & 7)
return sieve
def prime_list(n): #<----- You have to call me if you wanna get list of primes upto range n
"""returns a list of primes <= n"""
res = []
if n > 1:
res.append(2)
if n > 2:
res.append(3)
if n > 4:
sieve = prime_sieve(n + 1)
res.extend(3 * i + 1 | 1 for i in range(1, (n + 1) // 3 + (n % 6 == 1)) if not (sieve[i >> 3] >> (i & 7)) & 1)
return res
def is_prime(n):
"""returns True if n is prime else False"""
if n < 5 or n & 1 == 0 or n % 3 == 0:
return 2 <= n <= 3
s = ((n - 1) & (1 - n)).bit_length() - 1
d = n >> s
for a in [2, 325, 9375, 28178, 450775, 9780504, 1795265022]:
p = pow(a, d, n)
if p == 1 or p == n - 1 or a % n == 0:
continue
for _ in range(s):
p = (p * p) % n
if p == n - 1:
break
else:
return False
return True
def all_factors(n):
"""returns a sorted list of all distinct factors of n"""
small, large = [],[]
for i in range(1, int(n**0.5) + 1, 2 if n & 1 else 1):
if not n % i:
small.append(i)
large.append(n//i)
large.reverse()
small.extend(large)
return small
def get_array(): return list(map(int, sys.stdin.readline().strip().split()))
def get_ints(): return map(int, sys.stdin.readline().strip().split())
def input(): return sys.stdin.readline().strip()
# ///===========MAIN=============///
n,b=get_ints()
Arr=get_array()
even_suf=[0]*n
odd_suf=[0]*n
if Arr[0]&1:
odd_suf[0]=1
else:
even_suf[0]=1
for i in range(1,n):
if Arr[i]&1:
odd_suf[i]=odd_suf[i-1]+1
even_suf[i]=even_suf[i-1]
else:
even_suf[i]=even_suf[i-1]+1
odd_suf[i]=odd_suf[i-1]
result=[];flag=0
for i in range(1,n-1):
if odd_suf[i]==even_suf[i]:
result.append(abs(Arr[i]-Arr[i+1]))
flag=1
if flag==0:
print(0)
exit()
result.sort()
index=0
total=0
while(index<len(result) and total+result[index]<=b):
total+=result[index]
index+=1
print(index)
``` | 3 | |
50 | A | Domino piling | PROGRAMMING | 800 | [
"greedy",
"math"
] | A. Domino piling | 2 | 256 | You are given a rectangular board of *M*<=×<=*N* squares. Also you are given an unlimited number of standard domino pieces of 2<=×<=1 squares. You are allowed to rotate the pieces. You are asked to place as many dominoes as possible on the board so as to meet the following conditions:
1. Each domino completely covers two squares.
2. No two dominoes overlap.
3. Each domino lies entirely inside the board. It is allowed to touch the edges of the board.
Find the maximum number of dominoes, which can be placed under these restrictions. | In a single line you are given two integers *M* and *N* — board sizes in squares (1<=≤<=*M*<=≤<=*N*<=≤<=16). | Output one number — the maximal number of dominoes, which can be placed. | [
"2 4\n",
"3 3\n"
] | [
"4\n",
"4\n"
] | none | 500 | [
{
"input": "2 4",
"output": "4"
},
{
"input": "3 3",
"output": "4"
},
{
"input": "1 5",
"output": "2"
},
{
"input": "1 6",
"output": "3"
},
{
"input": "1 15",
"output": "7"
},
{
"input": "1 16",
"output": "8"
},
{
"input": "2 5",
"outpu... | 1,644,587,564 | 2,147,483,647 | Python 3 | OK | TESTS | 35 | 92 | 0 | m,n = input().split()
casillas = int(m)*int(n)
p = 0
final = 0
for i in range(casillas):
p = p + 2
if p <= int(casillas):
final += 1
elif p == casillas:
print(final)
exit()
elif p > casillas:
print(final)
exit()
| Title: Domino piling
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
You are given a rectangular board of *M*<=×<=*N* squares. Also you are given an unlimited number of standard domino pieces of 2<=×<=1 squares. You are allowed to rotate the pieces. You are asked to place as many dominoes as possible on the board so as to meet the following conditions:
1. Each domino completely covers two squares.
2. No two dominoes overlap.
3. Each domino lies entirely inside the board. It is allowed to touch the edges of the board.
Find the maximum number of dominoes, which can be placed under these restrictions.
Input Specification:
In a single line you are given two integers *M* and *N* — board sizes in squares (1<=≤<=*M*<=≤<=*N*<=≤<=16).
Output Specification:
Output one number — the maximal number of dominoes, which can be placed.
Demo Input:
['2 4\n', '3 3\n']
Demo Output:
['4\n', '4\n']
Note:
none | ```python
m,n = input().split()
casillas = int(m)*int(n)
p = 0
final = 0
for i in range(casillas):
p = p + 2
if p <= int(casillas):
final += 1
elif p == casillas:
print(final)
exit()
elif p > casillas:
print(final)
exit()
``` | 3.977 |
262 | A | Roma and Lucky Numbers | PROGRAMMING | 800 | [
"implementation"
] | null | null | Roma (a popular Russian name that means 'Roman') loves the Little Lvov Elephant's lucky numbers.
Let us remind you that lucky numbers are positive integers whose decimal representation only contains lucky digits 4 and 7. For example, numbers 47, 744, 4 are lucky and 5, 17, 467 are not.
Roma's got *n* positive integers. He wonders, how many of those integers have not more than *k* lucky digits? Help him, write the program that solves the problem. | The first line contains two integers *n*, *k* (1<=≤<=*n*,<=*k*<=≤<=100). The second line contains *n* integers *a**i* (1<=≤<=*a**i*<=≤<=109) — the numbers that Roma has.
The numbers in the lines are separated by single spaces. | In a single line print a single integer — the answer to the problem. | [
"3 4\n1 2 4\n",
"3 2\n447 44 77\n"
] | [
"3\n",
"2\n"
] | In the first sample all numbers contain at most four lucky digits, so the answer is 3.
In the second sample number 447 doesn't fit in, as it contains more than two lucky digits. All other numbers are fine, so the answer is 2. | 500 | [
{
"input": "3 4\n1 2 4",
"output": "3"
},
{
"input": "3 2\n447 44 77",
"output": "2"
},
{
"input": "2 2\n507978501 180480073",
"output": "2"
},
{
"input": "9 6\n655243746 167613748 1470546 57644035 176077477 56984809 44677 215706823 369042089",
"output": "9"
},
{
... | 1,655,984,112 | 2,147,483,647 | Python 3 | OK | TESTS | 34 | 92 | 0 | def main():
[_, k] = list(map(int, input().split()))
ns = input().split()
t = 0
for n in ns:
q = 0
for c in str(n):
if c == '4' or c == '7':
q += 1
if q <= k:
t += 1
print(t)
if __name__ == "__main__":
main()
| Title: Roma and Lucky Numbers
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Roma (a popular Russian name that means 'Roman') loves the Little Lvov Elephant's lucky numbers.
Let us remind you that lucky numbers are positive integers whose decimal representation only contains lucky digits 4 and 7. For example, numbers 47, 744, 4 are lucky and 5, 17, 467 are not.
Roma's got *n* positive integers. He wonders, how many of those integers have not more than *k* lucky digits? Help him, write the program that solves the problem.
Input Specification:
The first line contains two integers *n*, *k* (1<=≤<=*n*,<=*k*<=≤<=100). The second line contains *n* integers *a**i* (1<=≤<=*a**i*<=≤<=109) — the numbers that Roma has.
The numbers in the lines are separated by single spaces.
Output Specification:
In a single line print a single integer — the answer to the problem.
Demo Input:
['3 4\n1 2 4\n', '3 2\n447 44 77\n']
Demo Output:
['3\n', '2\n']
Note:
In the first sample all numbers contain at most four lucky digits, so the answer is 3.
In the second sample number 447 doesn't fit in, as it contains more than two lucky digits. All other numbers are fine, so the answer is 2. | ```python
def main():
[_, k] = list(map(int, input().split()))
ns = input().split()
t = 0
for n in ns:
q = 0
for c in str(n):
if c == '4' or c == '7':
q += 1
if q <= k:
t += 1
print(t)
if __name__ == "__main__":
main()
``` | 3 | |
977 | A | Wrong Subtraction | PROGRAMMING | 800 | [
"implementation"
] | null | null | Little girl Tanya is learning how to decrease a number by one, but she does it wrong with a number consisting of two or more digits. Tanya subtracts one from a number by the following algorithm:
- if the last digit of the number is non-zero, she decreases the number by one; - if the last digit of the number is zero, she divides the number by 10 (i.e. removes the last digit).
You are given an integer number $n$. Tanya will subtract one from it $k$ times. Your task is to print the result after all $k$ subtractions.
It is guaranteed that the result will be positive integer number. | The first line of the input contains two integer numbers $n$ and $k$ ($2 \le n \le 10^9$, $1 \le k \le 50$) — the number from which Tanya will subtract and the number of subtractions correspondingly. | Print one integer number — the result of the decreasing $n$ by one $k$ times.
It is guaranteed that the result will be positive integer number. | [
"512 4\n",
"1000000000 9\n"
] | [
"50\n",
"1\n"
] | The first example corresponds to the following sequence: $512 \rightarrow 511 \rightarrow 510 \rightarrow 51 \rightarrow 50$. | 0 | [
{
"input": "512 4",
"output": "50"
},
{
"input": "1000000000 9",
"output": "1"
},
{
"input": "131203 11",
"output": "12"
},
{
"input": "999999999 50",
"output": "9999"
},
{
"input": "999999999 49",
"output": "99990"
},
{
"input": "131203 9",
"outpu... | 1,698,563,432 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 11 | 61 | 0 | n, k = map(int, input().split())
cnt = 0
while cnt < k:
if n % 10 != 0:
n -= 1
else:
n //= 10
cnt += 1
print(n) | Title: Wrong Subtraction
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Little girl Tanya is learning how to decrease a number by one, but she does it wrong with a number consisting of two or more digits. Tanya subtracts one from a number by the following algorithm:
- if the last digit of the number is non-zero, she decreases the number by one; - if the last digit of the number is zero, she divides the number by 10 (i.e. removes the last digit).
You are given an integer number $n$. Tanya will subtract one from it $k$ times. Your task is to print the result after all $k$ subtractions.
It is guaranteed that the result will be positive integer number.
Input Specification:
The first line of the input contains two integer numbers $n$ and $k$ ($2 \le n \le 10^9$, $1 \le k \le 50$) — the number from which Tanya will subtract and the number of subtractions correspondingly.
Output Specification:
Print one integer number — the result of the decreasing $n$ by one $k$ times.
It is guaranteed that the result will be positive integer number.
Demo Input:
['512 4\n', '1000000000 9\n']
Demo Output:
['50\n', '1\n']
Note:
The first example corresponds to the following sequence: $512 \rightarrow 511 \rightarrow 510 \rightarrow 51 \rightarrow 50$. | ```python
n, k = map(int, input().split())
cnt = 0
while cnt < k:
if n % 10 != 0:
n -= 1
else:
n //= 10
cnt += 1
print(n)
``` | 3 | |
609 | A | USB Flash Drives | PROGRAMMING | 800 | [
"greedy",
"implementation",
"sortings"
] | null | null | Sean is trying to save a large file to a USB flash drive. He has *n* USB flash drives with capacities equal to *a*1,<=*a*2,<=...,<=*a**n* megabytes. The file size is equal to *m* megabytes.
Find the minimum number of USB flash drives needed to write Sean's file, if he can split the file between drives. | The first line contains positive integer *n* (1<=≤<=*n*<=≤<=100) — the number of USB flash drives.
The second line contains positive integer *m* (1<=≤<=*m*<=≤<=105) — the size of Sean's file.
Each of the next *n* lines contains positive integer *a**i* (1<=≤<=*a**i*<=≤<=1000) — the sizes of USB flash drives in megabytes.
It is guaranteed that the answer exists, i. e. the sum of all *a**i* is not less than *m*. | Print the minimum number of USB flash drives to write Sean's file, if he can split the file between drives. | [
"3\n5\n2\n1\n3\n",
"3\n6\n2\n3\n2\n",
"2\n5\n5\n10\n"
] | [
"2\n",
"3\n",
"1\n"
] | In the first example Sean needs only two USB flash drives — the first and the third.
In the second example Sean needs all three USB flash drives.
In the third example Sean needs only one USB flash drive and he can use any available USB flash drive — the first or the second. | 0 | [
{
"input": "3\n5\n2\n1\n3",
"output": "2"
},
{
"input": "3\n6\n2\n3\n2",
"output": "3"
},
{
"input": "2\n5\n5\n10",
"output": "1"
},
{
"input": "5\n16\n8\n1\n3\n4\n9",
"output": "2"
},
{
"input": "10\n121\n10\n37\n74\n56\n42\n39\n6\n68\n8\n100",
"output": "2"
... | 1,567,814,643 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 6 | 108 | 0 | a=int(input())
b=int(input())
k=[]
for i in range(a):
k.append(int(input()))
tot=sum(k)
tot1=sum(k)
if tot==b:
print(a)
while k!=[]:
minIndex = k.index(min(k))
tot=tot1
tot1=tot1-min(k)
k.pop(minIndex)
if tot1<b:
print(len(k)+1)
break
| Title: USB Flash Drives
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Sean is trying to save a large file to a USB flash drive. He has *n* USB flash drives with capacities equal to *a*1,<=*a*2,<=...,<=*a**n* megabytes. The file size is equal to *m* megabytes.
Find the minimum number of USB flash drives needed to write Sean's file, if he can split the file between drives.
Input Specification:
The first line contains positive integer *n* (1<=≤<=*n*<=≤<=100) — the number of USB flash drives.
The second line contains positive integer *m* (1<=≤<=*m*<=≤<=105) — the size of Sean's file.
Each of the next *n* lines contains positive integer *a**i* (1<=≤<=*a**i*<=≤<=1000) — the sizes of USB flash drives in megabytes.
It is guaranteed that the answer exists, i. e. the sum of all *a**i* is not less than *m*.
Output Specification:
Print the minimum number of USB flash drives to write Sean's file, if he can split the file between drives.
Demo Input:
['3\n5\n2\n1\n3\n', '3\n6\n2\n3\n2\n', '2\n5\n5\n10\n']
Demo Output:
['2\n', '3\n', '1\n']
Note:
In the first example Sean needs only two USB flash drives — the first and the third.
In the second example Sean needs all three USB flash drives.
In the third example Sean needs only one USB flash drive and he can use any available USB flash drive — the first or the second. | ```python
a=int(input())
b=int(input())
k=[]
for i in range(a):
k.append(int(input()))
tot=sum(k)
tot1=sum(k)
if tot==b:
print(a)
while k!=[]:
minIndex = k.index(min(k))
tot=tot1
tot1=tot1-min(k)
k.pop(minIndex)
if tot1<b:
print(len(k)+1)
break
``` | 0 | |
702 | A | Maximum Increase | PROGRAMMING | 800 | [
"dp",
"greedy",
"implementation"
] | null | null | You are given array consisting of *n* integers. Your task is to find the maximum length of an increasing subarray of the given array.
A subarray is the sequence of consecutive elements of the array. Subarray is called increasing if each element of this subarray strictly greater than previous. | The first line contains single positive integer *n* (1<=≤<=*n*<=≤<=105) — the number of integers.
The second line contains *n* positive integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109). | Print the maximum length of an increasing subarray of the given array. | [
"5\n1 7 2 11 15\n",
"6\n100 100 100 100 100 100\n",
"3\n1 2 3\n"
] | [
"3\n",
"1\n",
"3\n"
] | none | 0 | [
{
"input": "5\n1 7 2 11 15",
"output": "3"
},
{
"input": "6\n100 100 100 100 100 100",
"output": "1"
},
{
"input": "3\n1 2 3",
"output": "3"
},
{
"input": "1\n1000000000",
"output": "1"
},
{
"input": "10\n802030518 598196518 640274071 983359971 71550121 96204862 7... | 1,654,315,933 | 2,147,483,647 | Python 3 | OK | TESTS | 32 | 108 | 7,884,800 | n = int(input())
l = list(map(int, input().split()))
count = 1
max_ = 1
for i in range(len(l)-1):
if l[i] < l[i+1]:
# print(l[i], l[i+1])
count += 1
# print(max_, count)
else:
if max_ < count:
max_ = count
count = 1
print(max(max_, count)) | Title: Maximum Increase
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given array consisting of *n* integers. Your task is to find the maximum length of an increasing subarray of the given array.
A subarray is the sequence of consecutive elements of the array. Subarray is called increasing if each element of this subarray strictly greater than previous.
Input Specification:
The first line contains single positive integer *n* (1<=≤<=*n*<=≤<=105) — the number of integers.
The second line contains *n* positive integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109).
Output Specification:
Print the maximum length of an increasing subarray of the given array.
Demo Input:
['5\n1 7 2 11 15\n', '6\n100 100 100 100 100 100\n', '3\n1 2 3\n']
Demo Output:
['3\n', '1\n', '3\n']
Note:
none | ```python
n = int(input())
l = list(map(int, input().split()))
count = 1
max_ = 1
for i in range(len(l)-1):
if l[i] < l[i+1]:
# print(l[i], l[i+1])
count += 1
# print(max_, count)
else:
if max_ < count:
max_ = count
count = 1
print(max(max_, count))
``` | 3 | |
816 | A | Karen and Morning | PROGRAMMING | 1,000 | [
"brute force",
"implementation"
] | null | null | Karen is getting ready for a new school day!
It is currently hh:mm, given in a 24-hour format. As you know, Karen loves palindromes, and she believes that it is good luck to wake up when the time is a palindrome.
What is the minimum number of minutes she should sleep, such that, when she wakes up, the time is a palindrome?
Remember that a palindrome is a string that reads the same forwards and backwards. For instance, 05:39 is not a palindrome, because 05:39 backwards is 93:50. On the other hand, 05:50 is a palindrome, because 05:50 backwards is 05:50. | The first and only line of input contains a single string in the format hh:mm (00<=≤<= hh <=≤<=23, 00<=≤<= mm <=≤<=59). | Output a single integer on a line by itself, the minimum number of minutes she should sleep, such that, when she wakes up, the time is a palindrome. | [
"05:39\n",
"13:31\n",
"23:59\n"
] | [
"11\n",
"0\n",
"1\n"
] | In the first test case, the minimum number of minutes Karen should sleep for is 11. She can wake up at 05:50, when the time is a palindrome.
In the second test case, Karen can wake up immediately, as the current time, 13:31, is already a palindrome.
In the third test case, the minimum number of minutes Karen should sleep for is 1 minute. She can wake up at 00:00, when the time is a palindrome. | 500 | [
{
"input": "05:39",
"output": "11"
},
{
"input": "13:31",
"output": "0"
},
{
"input": "23:59",
"output": "1"
},
{
"input": "13:32",
"output": "69"
},
{
"input": "14:40",
"output": "1"
},
{
"input": "14:00",
"output": "41"
},
{
"input": "05:... | 1,627,153,090 | 2,147,483,647 | Python 3 | OK | TESTS | 160 | 77 | 6,758,400 | h,m=map(int,input().split(":"))
i=0
while h//10!=m%10 or h%10!=m//10:
m=m+1
i=i+1
if m==60:
m=0
h=h+1
h=h%24
print(i) | Title: Karen and Morning
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Karen is getting ready for a new school day!
It is currently hh:mm, given in a 24-hour format. As you know, Karen loves palindromes, and she believes that it is good luck to wake up when the time is a palindrome.
What is the minimum number of minutes she should sleep, such that, when she wakes up, the time is a palindrome?
Remember that a palindrome is a string that reads the same forwards and backwards. For instance, 05:39 is not a palindrome, because 05:39 backwards is 93:50. On the other hand, 05:50 is a palindrome, because 05:50 backwards is 05:50.
Input Specification:
The first and only line of input contains a single string in the format hh:mm (00<=≤<= hh <=≤<=23, 00<=≤<= mm <=≤<=59).
Output Specification:
Output a single integer on a line by itself, the minimum number of minutes she should sleep, such that, when she wakes up, the time is a palindrome.
Demo Input:
['05:39\n', '13:31\n', '23:59\n']
Demo Output:
['11\n', '0\n', '1\n']
Note:
In the first test case, the minimum number of minutes Karen should sleep for is 11. She can wake up at 05:50, when the time is a palindrome.
In the second test case, Karen can wake up immediately, as the current time, 13:31, is already a palindrome.
In the third test case, the minimum number of minutes Karen should sleep for is 1 minute. She can wake up at 00:00, when the time is a palindrome. | ```python
h,m=map(int,input().split(":"))
i=0
while h//10!=m%10 or h%10!=m//10:
m=m+1
i=i+1
if m==60:
m=0
h=h+1
h=h%24
print(i)
``` | 3 | |
873 | B | Balanced Substring | PROGRAMMING | 1,500 | [
"dp",
"implementation"
] | null | null | You are given a string *s* consisting only of characters 0 and 1. A substring [*l*,<=*r*] of *s* is a string *s**l**s**l*<=+<=1*s**l*<=+<=2... *s**r*, and its length equals to *r*<=-<=*l*<=+<=1. A substring is called balanced if the number of zeroes (0) equals to the number of ones in this substring.
You have to determine the length of the longest balanced substring of *s*. | The first line contains *n* (1<=≤<=*n*<=≤<=100000) — the number of characters in *s*.
The second line contains a string *s* consisting of exactly *n* characters. Only characters 0 and 1 can appear in *s*. | If there is no non-empty balanced substring in *s*, print 0. Otherwise, print the length of the longest balanced substring. | [
"8\n11010111\n",
"3\n111\n"
] | [
"4\n",
"0\n"
] | In the first example you can choose the substring [3, 6]. It is balanced, and its length is 4. Choosing the substring [2, 5] is also possible.
In the second example it's impossible to find a non-empty balanced substring. | 0 | [
{
"input": "8\n11010111",
"output": "4"
},
{
"input": "3\n111",
"output": "0"
},
{
"input": "11\n00001000100",
"output": "2"
},
{
"input": "10\n0100000000",
"output": "2"
},
{
"input": "13\n0001000011010",
"output": "6"
},
{
"input": "14\n0000010010101... | 1,694,448,020 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 2 | 31 | 0 | def prefix(string, num=0):
pref = []
pref.append(0)
for i in range(1, len(string)+1):
if int(string[i-1]) == num:
pref.append(pref[i - 1] + 1)
else:
pref.append(pref[i - 1])
return pref
n = int(input())
str1 = input()
res1 = prefix(str1)
res2 = prefix(str1, 1)
max1 = max(res1)
max2 = max(res2)
if max1 > max2 and max2 in res1[1:]:
index1 = res1.index(max2,1)
index2 = res2.index(max2,1)
res = index2 - index1 + 1
elif max2 > max1 and max1 in res2[1:]:
index1 = res1.index(max1,1)
index2 = res2.index(max1,1)
res = index1 - index2 + 1
else:
res = 0
print(res)
| Title: Balanced Substring
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given a string *s* consisting only of characters 0 and 1. A substring [*l*,<=*r*] of *s* is a string *s**l**s**l*<=+<=1*s**l*<=+<=2... *s**r*, and its length equals to *r*<=-<=*l*<=+<=1. A substring is called balanced if the number of zeroes (0) equals to the number of ones in this substring.
You have to determine the length of the longest balanced substring of *s*.
Input Specification:
The first line contains *n* (1<=≤<=*n*<=≤<=100000) — the number of characters in *s*.
The second line contains a string *s* consisting of exactly *n* characters. Only characters 0 and 1 can appear in *s*.
Output Specification:
If there is no non-empty balanced substring in *s*, print 0. Otherwise, print the length of the longest balanced substring.
Demo Input:
['8\n11010111\n', '3\n111\n']
Demo Output:
['4\n', '0\n']
Note:
In the first example you can choose the substring [3, 6]. It is balanced, and its length is 4. Choosing the substring [2, 5] is also possible.
In the second example it's impossible to find a non-empty balanced substring. | ```python
def prefix(string, num=0):
pref = []
pref.append(0)
for i in range(1, len(string)+1):
if int(string[i-1]) == num:
pref.append(pref[i - 1] + 1)
else:
pref.append(pref[i - 1])
return pref
n = int(input())
str1 = input()
res1 = prefix(str1)
res2 = prefix(str1, 1)
max1 = max(res1)
max2 = max(res2)
if max1 > max2 and max2 in res1[1:]:
index1 = res1.index(max2,1)
index2 = res2.index(max2,1)
res = index2 - index1 + 1
elif max2 > max1 and max1 in res2[1:]:
index1 = res1.index(max1,1)
index2 = res2.index(max1,1)
res = index1 - index2 + 1
else:
res = 0
print(res)
``` | 0 | |
675 | B | Restoring Painting | PROGRAMMING | 1,400 | [
"brute force",
"constructive algorithms",
"math"
] | null | null | Vasya works as a watchman in the gallery. Unfortunately, one of the most expensive paintings was stolen while he was on duty. He doesn't want to be fired, so he has to quickly restore the painting. He remembers some facts about it.
- The painting is a square 3<=×<=3, each cell contains a single integer from 1 to *n*, and different cells may contain either different or equal integers. - The sum of integers in each of four squares 2<=×<=2 is equal to the sum of integers in the top left square 2<=×<=2. - Four elements *a*, *b*, *c* and *d* are known and are located as shown on the picture below.
Help Vasya find out the number of distinct squares the satisfy all the conditions above. Note, that this number may be equal to 0, meaning Vasya remembers something wrong.
Two squares are considered to be different, if there exists a cell that contains two different integers in different squares. | The first line of the input contains five integers *n*, *a*, *b*, *c* and *d* (1<=≤<=*n*<=≤<=100<=000, 1<=≤<=*a*,<=*b*,<=*c*,<=*d*<=≤<=*n*) — maximum possible value of an integer in the cell and four integers that Vasya remembers. | Print one integer — the number of distinct valid squares. | [
"2 1 1 1 2\n",
"3 3 1 2 3\n"
] | [
"2\n",
"6\n"
] | Below are all the possible paintings for the first sample. <img class="tex-graphics" src="https://espresso.codeforces.com/c4c53d4e7b6814d8aad7b72604b6089d61dadb48.png" style="max-width: 100.0%;max-height: 100.0%;"/> <img class="tex-graphics" src="https://espresso.codeforces.com/46a6ad6a5d3db202f3779b045b9dc77fc2348cf1.png" style="max-width: 100.0%;max-height: 100.0%;"/>
In the second sample, only paintings displayed below satisfy all the rules. <img class="tex-graphics" src="https://espresso.codeforces.com/776f231305f8ce7c33e79e887722ce46aa8b6e61.png" style="max-width: 100.0%;max-height: 100.0%;"/> <img class="tex-graphics" src="https://espresso.codeforces.com/2fce9e9a31e70f1e46ea26f11d7305b3414e9b6b.png" style="max-width: 100.0%;max-height: 100.0%;"/> <img class="tex-graphics" src="https://espresso.codeforces.com/be084a4d1f7e475be1183f7dff10e9c89eb175ef.png" style="max-width: 100.0%;max-height: 100.0%;"/> <img class="tex-graphics" src="https://espresso.codeforces.com/96afdb4a35ac14f595d29bea2282f621098902f4.png" style="max-width: 100.0%;max-height: 100.0%;"/> <img class="tex-graphics" src="https://espresso.codeforces.com/79ca8d720334a74910514f017ecf1d0166009a03.png" style="max-width: 100.0%;max-height: 100.0%;"/> <img class="tex-graphics" src="https://espresso.codeforces.com/ad3c37e950bf5702d54f05756db35c831da59ad9.png" style="max-width: 100.0%;max-height: 100.0%;"/> | 1,000 | [
{
"input": "2 1 1 1 2",
"output": "2"
},
{
"input": "3 3 1 2 3",
"output": "6"
},
{
"input": "1 1 1 1 1",
"output": "1"
},
{
"input": "1000 522 575 426 445",
"output": "774000"
},
{
"input": "99000 52853 14347 64237 88869",
"output": "1296306000"
},
{
... | 1,570,560,946 | 5,146 | Python 3 | OK | TESTS | 58 | 296 | 0 | n, a, b, c, d = map(int, input().split())
ans = 0
for centro in range(1, n+1):
q1 = a + b + centro
q2 = a + c + centro
q3 = b + d + centro
q4 = c + d + centro
v = [q1, q2, q3, q4]
v.sort()
q_min = v[0]
q_max = v[-1]
if q_min + n < q_max + 1:
continue
elif q_min + n == q_max + 1:
ans += 1
else:
ans += (q_min + n) - (q_max + 1) + 1
print(ans)
| Title: Restoring Painting
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya works as a watchman in the gallery. Unfortunately, one of the most expensive paintings was stolen while he was on duty. He doesn't want to be fired, so he has to quickly restore the painting. He remembers some facts about it.
- The painting is a square 3<=×<=3, each cell contains a single integer from 1 to *n*, and different cells may contain either different or equal integers. - The sum of integers in each of four squares 2<=×<=2 is equal to the sum of integers in the top left square 2<=×<=2. - Four elements *a*, *b*, *c* and *d* are known and are located as shown on the picture below.
Help Vasya find out the number of distinct squares the satisfy all the conditions above. Note, that this number may be equal to 0, meaning Vasya remembers something wrong.
Two squares are considered to be different, if there exists a cell that contains two different integers in different squares.
Input Specification:
The first line of the input contains five integers *n*, *a*, *b*, *c* and *d* (1<=≤<=*n*<=≤<=100<=000, 1<=≤<=*a*,<=*b*,<=*c*,<=*d*<=≤<=*n*) — maximum possible value of an integer in the cell and four integers that Vasya remembers.
Output Specification:
Print one integer — the number of distinct valid squares.
Demo Input:
['2 1 1 1 2\n', '3 3 1 2 3\n']
Demo Output:
['2\n', '6\n']
Note:
Below are all the possible paintings for the first sample. <img class="tex-graphics" src="https://espresso.codeforces.com/c4c53d4e7b6814d8aad7b72604b6089d61dadb48.png" style="max-width: 100.0%;max-height: 100.0%;"/> <img class="tex-graphics" src="https://espresso.codeforces.com/46a6ad6a5d3db202f3779b045b9dc77fc2348cf1.png" style="max-width: 100.0%;max-height: 100.0%;"/>
In the second sample, only paintings displayed below satisfy all the rules. <img class="tex-graphics" src="https://espresso.codeforces.com/776f231305f8ce7c33e79e887722ce46aa8b6e61.png" style="max-width: 100.0%;max-height: 100.0%;"/> <img class="tex-graphics" src="https://espresso.codeforces.com/2fce9e9a31e70f1e46ea26f11d7305b3414e9b6b.png" style="max-width: 100.0%;max-height: 100.0%;"/> <img class="tex-graphics" src="https://espresso.codeforces.com/be084a4d1f7e475be1183f7dff10e9c89eb175ef.png" style="max-width: 100.0%;max-height: 100.0%;"/> <img class="tex-graphics" src="https://espresso.codeforces.com/96afdb4a35ac14f595d29bea2282f621098902f4.png" style="max-width: 100.0%;max-height: 100.0%;"/> <img class="tex-graphics" src="https://espresso.codeforces.com/79ca8d720334a74910514f017ecf1d0166009a03.png" style="max-width: 100.0%;max-height: 100.0%;"/> <img class="tex-graphics" src="https://espresso.codeforces.com/ad3c37e950bf5702d54f05756db35c831da59ad9.png" style="max-width: 100.0%;max-height: 100.0%;"/> | ```python
n, a, b, c, d = map(int, input().split())
ans = 0
for centro in range(1, n+1):
q1 = a + b + centro
q2 = a + c + centro
q3 = b + d + centro
q4 = c + d + centro
v = [q1, q2, q3, q4]
v.sort()
q_min = v[0]
q_max = v[-1]
if q_min + n < q_max + 1:
continue
elif q_min + n == q_max + 1:
ans += 1
else:
ans += (q_min + n) - (q_max + 1) + 1
print(ans)
``` | 3 | |
514 | A | Chewbaсca and Number | PROGRAMMING | 1,200 | [
"greedy",
"implementation"
] | null | null | Luke Skywalker gave Chewbacca an integer number *x*. Chewbacca isn't good at numbers but he loves inverting digits in them. Inverting digit *t* means replacing it with digit 9<=-<=*t*.
Help Chewbacca to transform the initial number *x* to the minimum possible positive number by inverting some (possibly, zero) digits. The decimal representation of the final number shouldn't start with a zero. | The first line contains a single integer *x* (1<=≤<=*x*<=≤<=1018) — the number that Luke Skywalker gave to Chewbacca. | Print the minimum possible positive number that Chewbacca can obtain after inverting some digits. The number shouldn't contain leading zeroes. | [
"27\n",
"4545\n"
] | [
"22\n",
"4444\n"
] | none | 500 | [
{
"input": "27",
"output": "22"
},
{
"input": "4545",
"output": "4444"
},
{
"input": "1",
"output": "1"
},
{
"input": "9",
"output": "9"
},
{
"input": "8772",
"output": "1222"
},
{
"input": "81",
"output": "11"
},
{
"input": "71723447",
... | 1,690,623,841 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 38 | 46 | 0 | def m(c):
if c in "56789":
return str(9 - int(c))
return c
a = list(input())
s = 0
for i in range(len(a)):
if s == 0:
if a[i] == '9':
continue
s = 1
a[i] = m(a[i])
else:
a[i] = m(a[i])
if a == ['0']:
print(9)
else:
print("".join(a))
| Title: Chewbaсca and Number
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Luke Skywalker gave Chewbacca an integer number *x*. Chewbacca isn't good at numbers but he loves inverting digits in them. Inverting digit *t* means replacing it with digit 9<=-<=*t*.
Help Chewbacca to transform the initial number *x* to the minimum possible positive number by inverting some (possibly, zero) digits. The decimal representation of the final number shouldn't start with a zero.
Input Specification:
The first line contains a single integer *x* (1<=≤<=*x*<=≤<=1018) — the number that Luke Skywalker gave to Chewbacca.
Output Specification:
Print the minimum possible positive number that Chewbacca can obtain after inverting some digits. The number shouldn't contain leading zeroes.
Demo Input:
['27\n', '4545\n']
Demo Output:
['22\n', '4444\n']
Note:
none | ```python
def m(c):
if c in "56789":
return str(9 - int(c))
return c
a = list(input())
s = 0
for i in range(len(a)):
if s == 0:
if a[i] == '9':
continue
s = 1
a[i] = m(a[i])
else:
a[i] = m(a[i])
if a == ['0']:
print(9)
else:
print("".join(a))
``` | 0 | |
270 | A | Fancy Fence | PROGRAMMING | 1,100 | [
"geometry",
"implementation",
"math"
] | null | null | Emuskald needs a fence around his farm, but he is too lazy to build it himself. So he purchased a fence-building robot.
He wants the fence to be a regular polygon. The robot builds the fence along a single path, but it can only make fence corners at a single angle *a*.
Will the robot be able to build the fence Emuskald wants? In other words, is there a regular polygon which angles are equal to *a*? | The first line of input contains an integer *t* (0<=<<=*t*<=<<=180) — the number of tests. Each of the following *t* lines contains a single integer *a* (0<=<<=*a*<=<<=180) — the angle the robot can make corners at measured in degrees. | For each test, output on a single line "YES" (without quotes), if the robot can build a fence Emuskald wants, and "NO" (without quotes), if it is impossible. | [
"3\n30\n60\n90\n"
] | [
"NO\nYES\nYES\n"
] | In the first test case, it is impossible to build the fence, since there is no regular polygon with angle <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/df5f4b07dd5316fde165b43657b2696e2919e791.png" style="max-width: 100.0%;max-height: 100.0%;"/>.
In the second test case, the fence is a regular triangle, and in the last test case — a square. | 500 | [
{
"input": "3\n30\n60\n90",
"output": "NO\nYES\nYES"
},
{
"input": "6\n1\n2\n3\n170\n179\n25",
"output": "NO\nNO\nNO\nYES\nYES\nNO"
}
] | 1,632,871,963 | 2,147,483,647 | Python 3 | COMPILATION_ERROR | TESTS | 0 | 0 | 0 | n=int(input))
for j in range(n):
k=int(input())
if k<60 :
print('NO')
elif 360%(180-k)==o:
print('YES')
else:
print('NO')
| Title: Fancy Fence
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Emuskald needs a fence around his farm, but he is too lazy to build it himself. So he purchased a fence-building robot.
He wants the fence to be a regular polygon. The robot builds the fence along a single path, but it can only make fence corners at a single angle *a*.
Will the robot be able to build the fence Emuskald wants? In other words, is there a regular polygon which angles are equal to *a*?
Input Specification:
The first line of input contains an integer *t* (0<=<<=*t*<=<<=180) — the number of tests. Each of the following *t* lines contains a single integer *a* (0<=<<=*a*<=<<=180) — the angle the robot can make corners at measured in degrees.
Output Specification:
For each test, output on a single line "YES" (without quotes), if the robot can build a fence Emuskald wants, and "NO" (without quotes), if it is impossible.
Demo Input:
['3\n30\n60\n90\n']
Demo Output:
['NO\nYES\nYES\n']
Note:
In the first test case, it is impossible to build the fence, since there is no regular polygon with angle <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/df5f4b07dd5316fde165b43657b2696e2919e791.png" style="max-width: 100.0%;max-height: 100.0%;"/>.
In the second test case, the fence is a regular triangle, and in the last test case — a square. | ```python
n=int(input))
for j in range(n):
k=int(input())
if k<60 :
print('NO')
elif 360%(180-k)==o:
print('YES')
else:
print('NO')
``` | -1 | |
2 | A | Winner | PROGRAMMING | 1,500 | [
"hashing",
"implementation"
] | A. Winner | 1 | 64 | The winner of the card game popular in Berland "Berlogging" is determined according to the following rules. If at the end of the game there is only one player with the maximum number of points, he is the winner. The situation becomes more difficult if the number of such players is more than one. During each round a player gains or loses a particular number of points. In the course of the game the number of points is registered in the line "name score", where name is a player's name, and score is the number of points gained in this round, which is an integer number. If score is negative, this means that the player has lost in the round. So, if two or more players have the maximum number of points (say, it equals to *m*) at the end of the game, than wins the one of them who scored at least *m* points first. Initially each player has 0 points. It's guaranteed that at the end of the game at least one player has a positive number of points. | The first line contains an integer number *n* (1<=<=≤<=<=*n*<=<=≤<=<=1000), *n* is the number of rounds played. Then follow *n* lines, containing the information about the rounds in "name score" format in chronological order, where name is a string of lower-case Latin letters with the length from 1 to 32, and score is an integer number between -1000 and 1000, inclusive. | Print the name of the winner. | [
"3\nmike 3\nandrew 5\nmike 2\n",
"3\nandrew 3\nandrew 2\nmike 5\n"
] | [
"andrew\n",
"andrew\n"
] | none | 0 | [
{
"input": "3\nmike 3\nandrew 5\nmike 2",
"output": "andrew"
},
{
"input": "3\nandrew 3\nandrew 2\nmike 5",
"output": "andrew"
},
{
"input": "5\nkaxqybeultn -352\nmgochgrmeyieyskhuourfg -910\nkaxqybeultn 691\nmgochgrmeyieyskhuourfg -76\nkaxqybeultn -303",
"output": "kaxqybeultn"
},... | 1,463,460,339 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 92 | 4,505,600 | n = int(input())
d = {}
for i in range(n):
ins = input().split(" ")
iname = ins[0]
iscore = int(ins[1])
xt = d.get(iname)
if xt != None:
iscore += xt[0]
d.update({iname: (iscore, i)})
w = ["", (0, 0)]
for t in d.items():
if t[1][0] > w[1][0] or (t[1][0] == w[1][0] and t[1][1] < w[1][1]):
w = t
print(t[0])
| Title: Winner
Time Limit: 1 seconds
Memory Limit: 64 megabytes
Problem Description:
The winner of the card game popular in Berland "Berlogging" is determined according to the following rules. If at the end of the game there is only one player with the maximum number of points, he is the winner. The situation becomes more difficult if the number of such players is more than one. During each round a player gains or loses a particular number of points. In the course of the game the number of points is registered in the line "name score", where name is a player's name, and score is the number of points gained in this round, which is an integer number. If score is negative, this means that the player has lost in the round. So, if two or more players have the maximum number of points (say, it equals to *m*) at the end of the game, than wins the one of them who scored at least *m* points first. Initially each player has 0 points. It's guaranteed that at the end of the game at least one player has a positive number of points.
Input Specification:
The first line contains an integer number *n* (1<=<=≤<=<=*n*<=<=≤<=<=1000), *n* is the number of rounds played. Then follow *n* lines, containing the information about the rounds in "name score" format in chronological order, where name is a string of lower-case Latin letters with the length from 1 to 32, and score is an integer number between -1000 and 1000, inclusive.
Output Specification:
Print the name of the winner.
Demo Input:
['3\nmike 3\nandrew 5\nmike 2\n', '3\nandrew 3\nandrew 2\nmike 5\n']
Demo Output:
['andrew\n', 'andrew\n']
Note:
none | ```python
n = int(input())
d = {}
for i in range(n):
ins = input().split(" ")
iname = ins[0]
iscore = int(ins[1])
xt = d.get(iname)
if xt != None:
iscore += xt[0]
d.update({iname: (iscore, i)})
w = ["", (0, 0)]
for t in d.items():
if t[1][0] > w[1][0] or (t[1][0] == w[1][0] and t[1][1] < w[1][1]):
w = t
print(t[0])
``` | 0 |
837 | G | Functions On The Segments | PROGRAMMING | 2,500 | [
"data structures"
] | null | null | You have an array *f* of *n* functions.The function *f**i*(*x*) (1<=≤<=*i*<=≤<=*n*) is characterized by parameters: *x*1,<=*x*2,<=*y*1,<=*a*,<=*b*,<=*y*2 and take values:
- *y*1, if *x*<=≤<=*x*1. - *a*·*x*<=+<=*b*, if *x*1<=<<=*x*<=≤<=*x*2. - *y*2, if *x*<=><=*x*2.
There are *m* queries. Each query is determined by numbers *l*, *r* and *x*. For a query with number *i* (1<=≤<=*i*<=≤<=*m*), you need to calculate the sum of all *f**j*(*x**i*) where *l*<=≤<=*j*<=≤<=*r*. The value of *x**i* is calculated as follows: *x**i*<==<=(*x*<=+<=*last*) mod 109, where *last* is the answer to the query with number *i*<=-<=1. The value of *last* equals 0 if *i*<==<=1. | First line contains one integer number *n* (1<=≤<=*n*<=≤<=75000).
Each of the next *n* lines contains six integer numbers: *x*1,<=*x*2,<=*y*1,<=*a*,<=*b*,<=*y*2 (0<=≤<=*x*1<=<<=*x*2<=≤<=2·105, 0<=≤<=*y*1,<=*y*2<=≤<=109, 0<=≤<=*a*,<=*b*<=≤<=104).
Next line contains one integer number *m* (1<=≤<=*m*<=≤<=500000).
Each of the next *m* lines contains three integer numbers: *l*, *r* and *x* (1<=≤<=*l*<=≤<=*r*<=≤<=*n*, 0<=≤<=*x*<=≤<=109). | none | [
"1\n1 2 1 4 5 10\n1\n1 1 2\n",
"3\n2 5 1 1 1 4\n3 6 8 2 5 7\n1 3 5 1 4 10\n3\n1 3 3\n2 3 2\n1 2 5\n"
] | [
"13\n",
"19\n17\n11\n"
] | none | 0 | [
{
"input": "1\n1 2 1 4 5 10\n1\n1 1 2",
"output": "13"
},
{
"input": "3\n2 5 1 1 1 4\n3 6 8 2 5 7\n1 3 5 1 4 10\n3\n1 3 3\n2 3 2\n1 2 5",
"output": "19\n17\n11"
},
{
"input": "7\n4 8 562244866 6 8 140807945\n5 7 415374420 7 6 596093578\n3 4 766370993 3 7 973128805\n4 6 841321398 3 2 8931... | 1,690,495,159 | 2,147,483,647 | PyPy 3-64 | WRONG_ANSWER | TESTS | 0 | 46 | 0 | print("_RANDOM_GUESS_1690495159.3495986")# 1690495159.3496218 | Title: Functions On The Segments
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You have an array *f* of *n* functions.The function *f**i*(*x*) (1<=≤<=*i*<=≤<=*n*) is characterized by parameters: *x*1,<=*x*2,<=*y*1,<=*a*,<=*b*,<=*y*2 and take values:
- *y*1, if *x*<=≤<=*x*1. - *a*·*x*<=+<=*b*, if *x*1<=<<=*x*<=≤<=*x*2. - *y*2, if *x*<=><=*x*2.
There are *m* queries. Each query is determined by numbers *l*, *r* and *x*. For a query with number *i* (1<=≤<=*i*<=≤<=*m*), you need to calculate the sum of all *f**j*(*x**i*) where *l*<=≤<=*j*<=≤<=*r*. The value of *x**i* is calculated as follows: *x**i*<==<=(*x*<=+<=*last*) mod 109, where *last* is the answer to the query with number *i*<=-<=1. The value of *last* equals 0 if *i*<==<=1.
Input Specification:
First line contains one integer number *n* (1<=≤<=*n*<=≤<=75000).
Each of the next *n* lines contains six integer numbers: *x*1,<=*x*2,<=*y*1,<=*a*,<=*b*,<=*y*2 (0<=≤<=*x*1<=<<=*x*2<=≤<=2·105, 0<=≤<=*y*1,<=*y*2<=≤<=109, 0<=≤<=*a*,<=*b*<=≤<=104).
Next line contains one integer number *m* (1<=≤<=*m*<=≤<=500000).
Each of the next *m* lines contains three integer numbers: *l*, *r* and *x* (1<=≤<=*l*<=≤<=*r*<=≤<=*n*, 0<=≤<=*x*<=≤<=109).
Output Specification:
none
Demo Input:
['1\n1 2 1 4 5 10\n1\n1 1 2\n', '3\n2 5 1 1 1 4\n3 6 8 2 5 7\n1 3 5 1 4 10\n3\n1 3 3\n2 3 2\n1 2 5\n']
Demo Output:
['13\n', '19\n17\n11\n']
Note:
none | ```python
print("_RANDOM_GUESS_1690495159.3495986")# 1690495159.3496218
``` | 0 | |
776 | B | Sherlock and his girlfriend | PROGRAMMING | 1,200 | [
"constructive algorithms",
"number theory"
] | null | null | Sherlock has a new girlfriend (so unlike him!). Valentine's day is coming and he wants to gift her some jewelry.
He bought *n* pieces of jewelry. The *i*-th piece has price equal to *i*<=+<=1, that is, the prices of the jewelry are 2,<=3,<=4,<=... *n*<=+<=1.
Watson gave Sherlock a challenge to color these jewelry pieces such that two pieces don't have the same color if the price of one piece is a prime divisor of the price of the other piece. Also, Watson asked him to minimize the number of different colors used.
Help Sherlock complete this trivial task. | The only line contains single integer *n* (1<=≤<=*n*<=≤<=100000) — the number of jewelry pieces. | The first line of output should contain a single integer *k*, the minimum number of colors that can be used to color the pieces of jewelry with the given constraints.
The next line should consist of *n* space-separated integers (between 1 and *k*) that specify the color of each piece in the order of increasing price.
If there are multiple ways to color the pieces using *k* colors, you can output any of them. | [
"3\n",
"4\n"
] | [
"2\n1 1 2 ",
"2\n2 1 1 2\n"
] | In the first input, the colors for first, second and third pieces of jewelry having respective prices 2, 3 and 4 are 1, 1 and 2 respectively.
In this case, as 2 is a prime divisor of 4, colors of jewelry having prices 2 and 4 must be distinct. | 1,000 | [
{
"input": "3",
"output": "2\n1 1 2 "
},
{
"input": "4",
"output": "2\n1 1 2 1 "
},
{
"input": "17",
"output": "2\n1 1 2 1 2 1 2 2 2 1 2 1 2 2 2 1 2 "
},
{
"input": "25",
"output": "2\n1 1 2 1 2 1 2 2 2 1 2 1 2 2 2 1 2 1 2 2 2 1 2 2 2 "
},
{
"input": "85",
"ou... | 1,649,050,264 | 2,147,483,647 | PyPy 3-64 | WRONG_ANSWER | TESTS | 3 | 77 | 0 | #sieve of Eratosthenes
x=int(input())
mo=x+10
prime=[True for i in range(mo)]
prime[0]=False
prime[1]=False
# sieve only till root of n
for i in range(0,int((mo)**0.5),1):
if prime[i]:
for j in range(i*i,mo,i):
prime[j]=False
#print(*prime)
primes=[]
if x>2:
print(2)
else:
print(1)
for i in range(2,x+2):
if prime[i]:
print(1,end=" ")
else:
print(2,end=" ")
| Title: Sherlock and his girlfriend
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Sherlock has a new girlfriend (so unlike him!). Valentine's day is coming and he wants to gift her some jewelry.
He bought *n* pieces of jewelry. The *i*-th piece has price equal to *i*<=+<=1, that is, the prices of the jewelry are 2,<=3,<=4,<=... *n*<=+<=1.
Watson gave Sherlock a challenge to color these jewelry pieces such that two pieces don't have the same color if the price of one piece is a prime divisor of the price of the other piece. Also, Watson asked him to minimize the number of different colors used.
Help Sherlock complete this trivial task.
Input Specification:
The only line contains single integer *n* (1<=≤<=*n*<=≤<=100000) — the number of jewelry pieces.
Output Specification:
The first line of output should contain a single integer *k*, the minimum number of colors that can be used to color the pieces of jewelry with the given constraints.
The next line should consist of *n* space-separated integers (between 1 and *k*) that specify the color of each piece in the order of increasing price.
If there are multiple ways to color the pieces using *k* colors, you can output any of them.
Demo Input:
['3\n', '4\n']
Demo Output:
['2\n1 1 2 ', '2\n2 1 1 2\n']
Note:
In the first input, the colors for first, second and third pieces of jewelry having respective prices 2, 3 and 4 are 1, 1 and 2 respectively.
In this case, as 2 is a prime divisor of 4, colors of jewelry having prices 2 and 4 must be distinct. | ```python
#sieve of Eratosthenes
x=int(input())
mo=x+10
prime=[True for i in range(mo)]
prime[0]=False
prime[1]=False
# sieve only till root of n
for i in range(0,int((mo)**0.5),1):
if prime[i]:
for j in range(i*i,mo,i):
prime[j]=False
#print(*prime)
primes=[]
if x>2:
print(2)
else:
print(1)
for i in range(2,x+2):
if prime[i]:
print(1,end=" ")
else:
print(2,end=" ")
``` | 0 | |
217 | A | Ice Skating | PROGRAMMING | 1,200 | [
"brute force",
"dfs and similar",
"dsu",
"graphs"
] | null | null | Bajtek is learning to skate on ice. He's a beginner, so his only mode of transportation is pushing off from a snow drift to the north, east, south or west and sliding until he lands in another snow drift. He has noticed that in this way it's impossible to get from some snow drifts to some other by any sequence of moves. He now wants to heap up some additional snow drifts, so that he can get from any snow drift to any other one. He asked you to find the minimal number of snow drifts that need to be created.
We assume that Bajtek can only heap up snow drifts at integer coordinates. | The first line of input contains a single integer *n* (1<=≤<=*n*<=≤<=100) — the number of snow drifts. Each of the following *n* lines contains two integers *x**i* and *y**i* (1<=≤<=*x**i*,<=*y**i*<=≤<=1000) — the coordinates of the *i*-th snow drift.
Note that the north direction coinсides with the direction of *Oy* axis, so the east direction coinсides with the direction of the *Ox* axis. All snow drift's locations are distinct. | Output the minimal number of snow drifts that need to be created in order for Bajtek to be able to reach any snow drift from any other one. | [
"2\n2 1\n1 2\n",
"2\n2 1\n4 1\n"
] | [
"1\n",
"0\n"
] | none | 500 | [
{
"input": "2\n2 1\n1 2",
"output": "1"
},
{
"input": "2\n2 1\n4 1",
"output": "0"
},
{
"input": "24\n171 35\n261 20\n4 206\n501 446\n961 912\n581 748\n946 978\n463 514\n841 889\n341 466\n842 967\n54 102\n235 261\n925 889\n682 672\n623 636\n268 94\n635 710\n474 510\n697 794\n586 663\n182... | 1,670,291,882 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 0 | 60 | 512,000 | def calculate(elem):
if rank[elem] < 0:
rank[elem] = elem
if x != rank[elem]:
rank[elem]= calculate(rank[elem])
return rank[elem]
n = int(input())
rank = [-1] * 9999
for _ in range(n):
x, y = map(int, input().split())
y += 1000
n -= (rank[y] >= 0) + (rank[x] >= 0) - (calculate(y) == calculate(x))
rank[calculate(x)] = calculate(y)
print(n - 1)
| Title: Ice Skating
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Bajtek is learning to skate on ice. He's a beginner, so his only mode of transportation is pushing off from a snow drift to the north, east, south or west and sliding until he lands in another snow drift. He has noticed that in this way it's impossible to get from some snow drifts to some other by any sequence of moves. He now wants to heap up some additional snow drifts, so that he can get from any snow drift to any other one. He asked you to find the minimal number of snow drifts that need to be created.
We assume that Bajtek can only heap up snow drifts at integer coordinates.
Input Specification:
The first line of input contains a single integer *n* (1<=≤<=*n*<=≤<=100) — the number of snow drifts. Each of the following *n* lines contains two integers *x**i* and *y**i* (1<=≤<=*x**i*,<=*y**i*<=≤<=1000) — the coordinates of the *i*-th snow drift.
Note that the north direction coinсides with the direction of *Oy* axis, so the east direction coinсides with the direction of the *Ox* axis. All snow drift's locations are distinct.
Output Specification:
Output the minimal number of snow drifts that need to be created in order for Bajtek to be able to reach any snow drift from any other one.
Demo Input:
['2\n2 1\n1 2\n', '2\n2 1\n4 1\n']
Demo Output:
['1\n', '0\n']
Note:
none | ```python
def calculate(elem):
if rank[elem] < 0:
rank[elem] = elem
if x != rank[elem]:
rank[elem]= calculate(rank[elem])
return rank[elem]
n = int(input())
rank = [-1] * 9999
for _ in range(n):
x, y = map(int, input().split())
y += 1000
n -= (rank[y] >= 0) + (rank[x] >= 0) - (calculate(y) == calculate(x))
rank[calculate(x)] = calculate(y)
print(n - 1)
``` | -1 | |
920 | A | Water The Garden | PROGRAMMING | 1,000 | [
"implementation"
] | null | null | It is winter now, and Max decided it's about time he watered the garden.
The garden can be represented as *n* consecutive garden beds, numbered from 1 to *n*. *k* beds contain water taps (*i*-th tap is located in the bed *x**i*), which, if turned on, start delivering water to neighbouring beds. If the tap on the bed *x**i* is turned on, then after one second has passed, the bed *x**i* will be watered; after two seconds have passed, the beds from the segment [*x**i*<=-<=1,<=*x**i*<=+<=1] will be watered (if they exist); after *j* seconds have passed (*j* is an integer number), the beds from the segment [*x**i*<=-<=(*j*<=-<=1),<=*x**i*<=+<=(*j*<=-<=1)] will be watered (if they exist). Nothing changes during the seconds, so, for example, we can't say that the segment [*x**i*<=-<=2.5,<=*x**i*<=+<=2.5] will be watered after 2.5 seconds have passed; only the segment [*x**i*<=-<=2,<=*x**i*<=+<=2] will be watered at that moment.
Max wants to turn on all the water taps at the same moment, and now he wonders, what is the minimum number of seconds that have to pass after he turns on some taps until the whole garden is watered. Help him to find the answer! | The first line contains one integer *t* — the number of test cases to solve (1<=≤<=*t*<=≤<=200).
Then *t* test cases follow. The first line of each test case contains two integers *n* and *k* (1<=≤<=*n*<=≤<=200, 1<=≤<=*k*<=≤<=*n*) — the number of garden beds and water taps, respectively.
Next line contains *k* integers *x**i* (1<=≤<=*x**i*<=≤<=*n*) — the location of *i*-th water tap. It is guaranteed that for each condition *x**i*<=-<=1<=<<=*x**i* holds.
It is guaranteed that the sum of *n* over all test cases doesn't exceed 200.
Note that in hacks you have to set *t*<==<=1. | For each test case print one integer — the minimum number of seconds that have to pass after Max turns on some of the water taps, until the whole garden is watered. | [
"3\n5 1\n3\n3 3\n1 2 3\n4 1\n1\n"
] | [
"3\n1\n4\n"
] | The first example consists of 3 tests:
1. There are 5 garden beds, and a water tap in the bed 3. If we turn it on, then after 1 second passes, only bed 3 will be watered; after 2 seconds pass, beds [1, 3] will be watered, and after 3 seconds pass, everything will be watered. 1. There are 3 garden beds, and there is a water tap in each one. If we turn all of them on, then everything will be watered after 1 second passes. 1. There are 4 garden beds, and only one tap in the bed 1. It will take 4 seconds to water, for example, bed 4. | 0 | [
{
"input": "3\n5 1\n3\n3 3\n1 2 3\n4 1\n1",
"output": "3\n1\n4"
},
{
"input": "26\n1 1\n1\n2 1\n2\n2 1\n1\n2 2\n1 2\n3 1\n3\n3 1\n2\n3 2\n2 3\n3 1\n1\n3 2\n1 3\n3 2\n1 2\n3 3\n1 2 3\n4 1\n4\n4 1\n3\n4 2\n3 4\n4 1\n2\n4 2\n2 4\n4 2\n2 3\n4 3\n2 3 4\n4 1\n1\n4 2\n1 4\n4 2\n1 3\n4 3\n1 3 4\n4 2\n1 2\n4... | 1,606,739,971 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 108 | 307,200 | for z in range(int(input())):
a, b = list(map(int, input().split()))
c = sorted(list(map(int, input().split())))
e = c[0]
f = 0
for i in range(1, len(c)):
f = max(e, -(-(c[i] - c[i - 1]) // 2))
e = -(-(c[i] - c[i - 1]) // 2)
print(a - c[-1] + 1, f)
print(max(a - c[-1] + 1, f)) | Title: Water The Garden
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
It is winter now, and Max decided it's about time he watered the garden.
The garden can be represented as *n* consecutive garden beds, numbered from 1 to *n*. *k* beds contain water taps (*i*-th tap is located in the bed *x**i*), which, if turned on, start delivering water to neighbouring beds. If the tap on the bed *x**i* is turned on, then after one second has passed, the bed *x**i* will be watered; after two seconds have passed, the beds from the segment [*x**i*<=-<=1,<=*x**i*<=+<=1] will be watered (if they exist); after *j* seconds have passed (*j* is an integer number), the beds from the segment [*x**i*<=-<=(*j*<=-<=1),<=*x**i*<=+<=(*j*<=-<=1)] will be watered (if they exist). Nothing changes during the seconds, so, for example, we can't say that the segment [*x**i*<=-<=2.5,<=*x**i*<=+<=2.5] will be watered after 2.5 seconds have passed; only the segment [*x**i*<=-<=2,<=*x**i*<=+<=2] will be watered at that moment.
Max wants to turn on all the water taps at the same moment, and now he wonders, what is the minimum number of seconds that have to pass after he turns on some taps until the whole garden is watered. Help him to find the answer!
Input Specification:
The first line contains one integer *t* — the number of test cases to solve (1<=≤<=*t*<=≤<=200).
Then *t* test cases follow. The first line of each test case contains two integers *n* and *k* (1<=≤<=*n*<=≤<=200, 1<=≤<=*k*<=≤<=*n*) — the number of garden beds and water taps, respectively.
Next line contains *k* integers *x**i* (1<=≤<=*x**i*<=≤<=*n*) — the location of *i*-th water tap. It is guaranteed that for each condition *x**i*<=-<=1<=<<=*x**i* holds.
It is guaranteed that the sum of *n* over all test cases doesn't exceed 200.
Note that in hacks you have to set *t*<==<=1.
Output Specification:
For each test case print one integer — the minimum number of seconds that have to pass after Max turns on some of the water taps, until the whole garden is watered.
Demo Input:
['3\n5 1\n3\n3 3\n1 2 3\n4 1\n1\n']
Demo Output:
['3\n1\n4\n']
Note:
The first example consists of 3 tests:
1. There are 5 garden beds, and a water tap in the bed 3. If we turn it on, then after 1 second passes, only bed 3 will be watered; after 2 seconds pass, beds [1, 3] will be watered, and after 3 seconds pass, everything will be watered. 1. There are 3 garden beds, and there is a water tap in each one. If we turn all of them on, then everything will be watered after 1 second passes. 1. There are 4 garden beds, and only one tap in the bed 1. It will take 4 seconds to water, for example, bed 4. | ```python
for z in range(int(input())):
a, b = list(map(int, input().split()))
c = sorted(list(map(int, input().split())))
e = c[0]
f = 0
for i in range(1, len(c)):
f = max(e, -(-(c[i] - c[i - 1]) // 2))
e = -(-(c[i] - c[i - 1]) // 2)
print(a - c[-1] + 1, f)
print(max(a - c[-1] + 1, f))
``` | 0 | |
721 | A | One-dimensional Japanese Crossword | PROGRAMMING | 800 | [
"implementation"
] | null | null | Recently Adaltik discovered japanese crosswords. Japanese crossword is a picture, represented as a table sized *a*<=×<=*b* squares, and each square is colored white or black. There are integers to the left of the rows and to the top of the columns, encrypting the corresponding row or column. The number of integers represents how many groups of black squares there are in corresponding row or column, and the integers themselves represents the number of consecutive black squares in corresponding group (you can find more detailed explanation in Wikipedia [https://en.wikipedia.org/wiki/Japanese_crossword](https://en.wikipedia.org/wiki/Japanese_crossword)).
Adaltik decided that the general case of japanese crossword is too complicated and drew a row consisting of *n* squares (e.g. japanese crossword sized 1<=×<=*n*), which he wants to encrypt in the same way as in japanese crossword.
Help Adaltik find the numbers encrypting the row he drew. | The first line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=100) — the length of the row. The second line of the input contains a single string consisting of *n* characters 'B' or 'W', ('B' corresponds to black square, 'W' — to white square in the row that Adaltik drew). | The first line should contain a single integer *k* — the number of integers encrypting the row, e.g. the number of groups of black squares in the row.
The second line should contain *k* integers, encrypting the row, e.g. corresponding to sizes of groups of consecutive black squares in the order from left to right. | [
"3\nBBW\n",
"5\nBWBWB\n",
"4\nWWWW\n",
"4\nBBBB\n",
"13\nWBBBBWWBWBBBW\n"
] | [
"1\n2 ",
"3\n1 1 1 ",
"0\n",
"1\n4 ",
"3\n4 1 3 "
] | The last sample case correspond to the picture in the statement. | 500 | [
{
"input": "3\nBBW",
"output": "1\n2 "
},
{
"input": "5\nBWBWB",
"output": "3\n1 1 1 "
},
{
"input": "4\nWWWW",
"output": "0"
},
{
"input": "4\nBBBB",
"output": "1\n4 "
},
{
"input": "13\nWBBBBWWBWBBBW",
"output": "3\n4 1 3 "
},
{
"input": "1\nB",
... | 1,633,962,872 | 2,147,483,647 | PyPy 3 | OK | TESTS | 54 | 93 | 20,172,800 | if __name__ == "__main__":
n = int(input())
string = input()
res, total = [], 0
count = 0
for s in string:
if s == "B":
count += 1
else:
if count != 0:
total += 1
res.append(str(count))
count = 0
if count != 0:
total += 1
res.append(str(count))
print(total)
if len(res) != 0:
print(' '.join(res))
| Title: One-dimensional Japanese Crossword
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Recently Adaltik discovered japanese crosswords. Japanese crossword is a picture, represented as a table sized *a*<=×<=*b* squares, and each square is colored white or black. There are integers to the left of the rows and to the top of the columns, encrypting the corresponding row or column. The number of integers represents how many groups of black squares there are in corresponding row or column, and the integers themselves represents the number of consecutive black squares in corresponding group (you can find more detailed explanation in Wikipedia [https://en.wikipedia.org/wiki/Japanese_crossword](https://en.wikipedia.org/wiki/Japanese_crossword)).
Adaltik decided that the general case of japanese crossword is too complicated and drew a row consisting of *n* squares (e.g. japanese crossword sized 1<=×<=*n*), which he wants to encrypt in the same way as in japanese crossword.
Help Adaltik find the numbers encrypting the row he drew.
Input Specification:
The first line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=100) — the length of the row. The second line of the input contains a single string consisting of *n* characters 'B' or 'W', ('B' corresponds to black square, 'W' — to white square in the row that Adaltik drew).
Output Specification:
The first line should contain a single integer *k* — the number of integers encrypting the row, e.g. the number of groups of black squares in the row.
The second line should contain *k* integers, encrypting the row, e.g. corresponding to sizes of groups of consecutive black squares in the order from left to right.
Demo Input:
['3\nBBW\n', '5\nBWBWB\n', '4\nWWWW\n', '4\nBBBB\n', '13\nWBBBBWWBWBBBW\n']
Demo Output:
['1\n2 ', '3\n1 1 1 ', '0\n', '1\n4 ', '3\n4 1 3 ']
Note:
The last sample case correspond to the picture in the statement. | ```python
if __name__ == "__main__":
n = int(input())
string = input()
res, total = [], 0
count = 0
for s in string:
if s == "B":
count += 1
else:
if count != 0:
total += 1
res.append(str(count))
count = 0
if count != 0:
total += 1
res.append(str(count))
print(total)
if len(res) != 0:
print(' '.join(res))
``` | 3 | |
461 | A | Appleman and Toastman | PROGRAMMING | 1,200 | [
"greedy",
"sortings"
] | null | null | Appleman and Toastman play a game. Initially Appleman gives one group of *n* numbers to the Toastman, then they start to complete the following tasks:
- Each time Toastman gets a group of numbers, he sums up all the numbers and adds this sum to the score. Then he gives the group to the Appleman. - Each time Appleman gets a group consisting of a single number, he throws this group out. Each time Appleman gets a group consisting of more than one number, he splits the group into two non-empty groups (he can do it in any way) and gives each of them to Toastman.
After guys complete all the tasks they look at the score value. What is the maximum possible value of score they can get? | The first line contains a single integer *n* (1<=≤<=*n*<=≤<=3·105). The second line contains *n* integers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=106) — the initial group that is given to Toastman. | Print a single integer — the largest possible score. | [
"3\n3 1 5\n",
"1\n10\n"
] | [
"26\n",
"10\n"
] | Consider the following situation in the first example. Initially Toastman gets group [3, 1, 5] and adds 9 to the score, then he give the group to Appleman. Appleman splits group [3, 1, 5] into two groups: [3, 5] and [1]. Both of them should be given to Toastman. When Toastman receives group [1], he adds 1 to score and gives the group to Appleman (he will throw it out). When Toastman receives group [3, 5], he adds 8 to the score and gives the group to Appleman. Appleman splits [3, 5] in the only possible way: [5] and [3]. Then he gives both groups to Toastman. When Toastman receives [5], he adds 5 to the score and gives the group to Appleman (he will throws it out). When Toastman receives [3], he adds 3 to the score and gives the group to Appleman (he will throws it out). Finally Toastman have added 9 + 1 + 8 + 5 + 3 = 26 to the score. This is the optimal sequence of actions. | 500 | [
{
"input": "3\n3 1 5",
"output": "26"
},
{
"input": "1\n10",
"output": "10"
},
{
"input": "10\n8 10 2 5 6 2 4 7 2 1",
"output": "376"
},
{
"input": "10\n171308 397870 724672 431255 228496 892002 542924 718337 888642 161821",
"output": "40204082"
},
{
"input": "10\... | 1,449,766,691 | 2,147,483,647 | Python 3 | TIME_LIMIT_EXCEEDED | TESTS | 6 | 2,000 | 5,734,400 | n=int(input())
a=[int(i) for i in input().split()]
he=sum(a)
b=0
while b<n-1:
a.sort()
he=he+sum(a)
del a[0]
b=b+1
print(he) | Title: Appleman and Toastman
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Appleman and Toastman play a game. Initially Appleman gives one group of *n* numbers to the Toastman, then they start to complete the following tasks:
- Each time Toastman gets a group of numbers, he sums up all the numbers and adds this sum to the score. Then he gives the group to the Appleman. - Each time Appleman gets a group consisting of a single number, he throws this group out. Each time Appleman gets a group consisting of more than one number, he splits the group into two non-empty groups (he can do it in any way) and gives each of them to Toastman.
After guys complete all the tasks they look at the score value. What is the maximum possible value of score they can get?
Input Specification:
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=3·105). The second line contains *n* integers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=106) — the initial group that is given to Toastman.
Output Specification:
Print a single integer — the largest possible score.
Demo Input:
['3\n3 1 5\n', '1\n10\n']
Demo Output:
['26\n', '10\n']
Note:
Consider the following situation in the first example. Initially Toastman gets group [3, 1, 5] and adds 9 to the score, then he give the group to Appleman. Appleman splits group [3, 1, 5] into two groups: [3, 5] and [1]. Both of them should be given to Toastman. When Toastman receives group [1], he adds 1 to score and gives the group to Appleman (he will throw it out). When Toastman receives group [3, 5], he adds 8 to the score and gives the group to Appleman. Appleman splits [3, 5] in the only possible way: [5] and [3]. Then he gives both groups to Toastman. When Toastman receives [5], he adds 5 to the score and gives the group to Appleman (he will throws it out). When Toastman receives [3], he adds 3 to the score and gives the group to Appleman (he will throws it out). Finally Toastman have added 9 + 1 + 8 + 5 + 3 = 26 to the score. This is the optimal sequence of actions. | ```python
n=int(input())
a=[int(i) for i in input().split()]
he=sum(a)
b=0
while b<n-1:
a.sort()
he=he+sum(a)
del a[0]
b=b+1
print(he)
``` | 0 | |
931 | B | World Cup | PROGRAMMING | 1,200 | [
"constructive algorithms",
"implementation"
] | null | null | The last stage of Football World Cup is played using the play-off system.
There are *n* teams left in this stage, they are enumerated from 1 to *n*. Several rounds are held, in each round the remaining teams are sorted in the order of their ids, then the first in this order plays with the second, the third — with the fourth, the fifth — with the sixth, and so on. It is guaranteed that in each round there is even number of teams. The winner of each game advances to the next round, the loser is eliminated from the tournament, there are no draws. In the last round there is the only game with two remaining teams: the round is called the Final, the winner is called the champion, and the tournament is over.
Arkady wants his two favorite teams to play in the Final. Unfortunately, the team ids are already determined, and it may happen that it is impossible for teams to meet in the Final, because they are to meet in some earlier stage, if they are strong enough. Determine, in which round the teams with ids *a* and *b* can meet. | The only line contains three integers *n*, *a* and *b* (2<=≤<=*n*<=≤<=256, 1<=≤<=*a*,<=*b*<=≤<=*n*) — the total number of teams, and the ids of the teams that Arkady is interested in.
It is guaranteed that *n* is such that in each round an even number of team advance, and that *a* and *b* are not equal. | In the only line print "Final!" (without quotes), if teams *a* and *b* can meet in the Final.
Otherwise, print a single integer — the number of the round in which teams *a* and *b* can meet. The round are enumerated from 1. | [
"4 1 2\n",
"8 2 6\n",
"8 7 5\n"
] | [
"1\n",
"Final!\n",
"2\n"
] | In the first example teams 1 and 2 meet in the first round.
In the second example teams 2 and 6 can only meet in the third round, which is the Final, if they win all their opponents in earlier rounds.
In the third example the teams with ids 7 and 5 can meet in the second round, if they win their opponents in the first round. | 1,000 | [
{
"input": "4 1 2",
"output": "1"
},
{
"input": "8 2 6",
"output": "Final!"
},
{
"input": "8 7 5",
"output": "2"
},
{
"input": "128 30 98",
"output": "Final!"
},
{
"input": "256 128 256",
"output": "Final!"
},
{
"input": "256 2 127",
"output": "7"
... | 1,520,179,288 | 1,588 | Python 3 | OK | TESTS | 64 | 77 | 5,632,000 | arr = input().split(' ')
n = int(arr[0])
a = int(arr[1])
b = int(arr[2])
a -= 1
b -= 1
ra = a//2
rb = b//2
c = 1
while ra!=rb:
ra = ra//2
rb = rb//2
c += 1
if(pow(2,c)==n): print("Final!")
else: print(c) | Title: World Cup
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The last stage of Football World Cup is played using the play-off system.
There are *n* teams left in this stage, they are enumerated from 1 to *n*. Several rounds are held, in each round the remaining teams are sorted in the order of their ids, then the first in this order plays with the second, the third — with the fourth, the fifth — with the sixth, and so on. It is guaranteed that in each round there is even number of teams. The winner of each game advances to the next round, the loser is eliminated from the tournament, there are no draws. In the last round there is the only game with two remaining teams: the round is called the Final, the winner is called the champion, and the tournament is over.
Arkady wants his two favorite teams to play in the Final. Unfortunately, the team ids are already determined, and it may happen that it is impossible for teams to meet in the Final, because they are to meet in some earlier stage, if they are strong enough. Determine, in which round the teams with ids *a* and *b* can meet.
Input Specification:
The only line contains three integers *n*, *a* and *b* (2<=≤<=*n*<=≤<=256, 1<=≤<=*a*,<=*b*<=≤<=*n*) — the total number of teams, and the ids of the teams that Arkady is interested in.
It is guaranteed that *n* is such that in each round an even number of team advance, and that *a* and *b* are not equal.
Output Specification:
In the only line print "Final!" (without quotes), if teams *a* and *b* can meet in the Final.
Otherwise, print a single integer — the number of the round in which teams *a* and *b* can meet. The round are enumerated from 1.
Demo Input:
['4 1 2\n', '8 2 6\n', '8 7 5\n']
Demo Output:
['1\n', 'Final!\n', '2\n']
Note:
In the first example teams 1 and 2 meet in the first round.
In the second example teams 2 and 6 can only meet in the third round, which is the Final, if they win all their opponents in earlier rounds.
In the third example the teams with ids 7 and 5 can meet in the second round, if they win their opponents in the first round. | ```python
arr = input().split(' ')
n = int(arr[0])
a = int(arr[1])
b = int(arr[2])
a -= 1
b -= 1
ra = a//2
rb = b//2
c = 1
while ra!=rb:
ra = ra//2
rb = rb//2
c += 1
if(pow(2,c)==n): print("Final!")
else: print(c)
``` | 3 | |
158 | A | Next Round | PROGRAMMING | 800 | [
"*special",
"implementation"
] | null | null | "Contestant who earns a score equal to or greater than the *k*-th place finisher's score will advance to the next round, as long as the contestant earns a positive score..." — an excerpt from contest rules.
A total of *n* participants took part in the contest (*n*<=≥<=*k*), and you already know their scores. Calculate how many participants will advance to the next round. | The first line of the input contains two integers *n* and *k* (1<=≤<=*k*<=≤<=*n*<=≤<=50) separated by a single space.
The second line contains *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=100), where *a**i* is the score earned by the participant who got the *i*-th place. The given sequence is non-increasing (that is, for all *i* from 1 to *n*<=-<=1 the following condition is fulfilled: *a**i*<=≥<=*a**i*<=+<=1). | Output the number of participants who advance to the next round. | [
"8 5\n10 9 8 7 7 7 5 5\n",
"4 2\n0 0 0 0\n"
] | [
"6\n",
"0\n"
] | In the first example the participant on the 5th place earned 7 points. As the participant on the 6th place also earned 7 points, there are 6 advancers.
In the second example nobody got a positive score. | 500 | [
{
"input": "8 5\n10 9 8 7 7 7 5 5",
"output": "6"
},
{
"input": "4 2\n0 0 0 0",
"output": "0"
},
{
"input": "5 1\n1 1 1 1 1",
"output": "5"
},
{
"input": "5 5\n1 1 1 1 1",
"output": "5"
},
{
"input": "1 1\n10",
"output": "1"
},
{
"input": "17 14\n16 15... | 1,698,826,858 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 0 | 30 | 0 | # Read the input integer
n = int(input())
# Get the first digit by converting the absolute value of the number to a string
first_digit = int(str(abs(n))[0])
# If the original number is negative, make the first digit negative as well
if n < 0:
first_digit = -first_digit
# Print the first digit
print(first_digit)
| Title: Next Round
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
"Contestant who earns a score equal to or greater than the *k*-th place finisher's score will advance to the next round, as long as the contestant earns a positive score..." — an excerpt from contest rules.
A total of *n* participants took part in the contest (*n*<=≥<=*k*), and you already know their scores. Calculate how many participants will advance to the next round.
Input Specification:
The first line of the input contains two integers *n* and *k* (1<=≤<=*k*<=≤<=*n*<=≤<=50) separated by a single space.
The second line contains *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=100), where *a**i* is the score earned by the participant who got the *i*-th place. The given sequence is non-increasing (that is, for all *i* from 1 to *n*<=-<=1 the following condition is fulfilled: *a**i*<=≥<=*a**i*<=+<=1).
Output Specification:
Output the number of participants who advance to the next round.
Demo Input:
['8 5\n10 9 8 7 7 7 5 5\n', '4 2\n0 0 0 0\n']
Demo Output:
['6\n', '0\n']
Note:
In the first example the participant on the 5th place earned 7 points. As the participant on the 6th place also earned 7 points, there are 6 advancers.
In the second example nobody got a positive score. | ```python
# Read the input integer
n = int(input())
# Get the first digit by converting the absolute value of the number to a string
first_digit = int(str(abs(n))[0])
# If the original number is negative, make the first digit negative as well
if n < 0:
first_digit = -first_digit
# Print the first digit
print(first_digit)
``` | -1 | |
69 | A | Young Physicist | PROGRAMMING | 1,000 | [
"implementation",
"math"
] | A. Young Physicist | 2 | 256 | A guy named Vasya attends the final grade of a high school. One day Vasya decided to watch a match of his favorite hockey team. And, as the boy loves hockey very much, even more than physics, he forgot to do the homework. Specifically, he forgot to complete his physics tasks. Next day the teacher got very angry at Vasya and decided to teach him a lesson. He gave the lazy student a seemingly easy task: You are given an idle body in space and the forces that affect it. The body can be considered as a material point with coordinates (0; 0; 0). Vasya had only to answer whether it is in equilibrium. "Piece of cake" — thought Vasya, we need only to check if the sum of all vectors is equal to 0. So, Vasya began to solve the problem. But later it turned out that there can be lots and lots of these forces, and Vasya can not cope without your help. Help him. Write a program that determines whether a body is idle or is moving by the given vectors of forces. | The first line contains a positive integer *n* (1<=≤<=*n*<=≤<=100), then follow *n* lines containing three integers each: the *x**i* coordinate, the *y**i* coordinate and the *z**i* coordinate of the force vector, applied to the body (<=-<=100<=≤<=*x**i*,<=*y**i*,<=*z**i*<=≤<=100). | Print the word "YES" if the body is in equilibrium, or the word "NO" if it is not. | [
"3\n4 1 7\n-2 4 -1\n1 -5 -3\n",
"3\n3 -1 7\n-5 2 -4\n2 -1 -3\n"
] | [
"NO",
"YES"
] | none | 500 | [
{
"input": "3\n4 1 7\n-2 4 -1\n1 -5 -3",
"output": "NO"
},
{
"input": "3\n3 -1 7\n-5 2 -4\n2 -1 -3",
"output": "YES"
},
{
"input": "10\n21 32 -46\n43 -35 21\n42 2 -50\n22 40 20\n-27 -9 38\n-4 1 1\n-40 6 -31\n-13 -2 34\n-21 34 -12\n-32 -29 41",
"output": "NO"
},
{
"input": "10... | 1,528,311,496 | 2,147,483,647 | Python 3 | OK | TESTS | 81 | 186 | 0 | n = int(input())
x = y = z = 0
for k in range(n):
m = list(map(int, input().split()))
x += m[0]
y += m[1]
z += m[2]
if x == y == z == 0:
print('YES')
else:
print('NO')
| Title: Young Physicist
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
A guy named Vasya attends the final grade of a high school. One day Vasya decided to watch a match of his favorite hockey team. And, as the boy loves hockey very much, even more than physics, he forgot to do the homework. Specifically, he forgot to complete his physics tasks. Next day the teacher got very angry at Vasya and decided to teach him a lesson. He gave the lazy student a seemingly easy task: You are given an idle body in space and the forces that affect it. The body can be considered as a material point with coordinates (0; 0; 0). Vasya had only to answer whether it is in equilibrium. "Piece of cake" — thought Vasya, we need only to check if the sum of all vectors is equal to 0. So, Vasya began to solve the problem. But later it turned out that there can be lots and lots of these forces, and Vasya can not cope without your help. Help him. Write a program that determines whether a body is idle or is moving by the given vectors of forces.
Input Specification:
The first line contains a positive integer *n* (1<=≤<=*n*<=≤<=100), then follow *n* lines containing three integers each: the *x**i* coordinate, the *y**i* coordinate and the *z**i* coordinate of the force vector, applied to the body (<=-<=100<=≤<=*x**i*,<=*y**i*,<=*z**i*<=≤<=100).
Output Specification:
Print the word "YES" if the body is in equilibrium, or the word "NO" if it is not.
Demo Input:
['3\n4 1 7\n-2 4 -1\n1 -5 -3\n', '3\n3 -1 7\n-5 2 -4\n2 -1 -3\n']
Demo Output:
['NO', 'YES']
Note:
none | ```python
n = int(input())
x = y = z = 0
for k in range(n):
m = list(map(int, input().split()))
x += m[0]
y += m[1]
z += m[2]
if x == y == z == 0:
print('YES')
else:
print('NO')
``` | 3.9535 |
234 | A | Lefthanders and Righthanders | PROGRAMMING | 1,200 | [
"implementation"
] | null | null | One fine October day a mathematics teacher Vasily Petrov went to a class and saw there *n* pupils who sat at the desks, two people at each desk. Vasily quickly realized that number *n* is even. Like all true mathematicians, Vasily has all students numbered from 1 to *n*.
But Vasily Petrov did not like the way the children were seated at the desks. According to him, the students whose numbers differ by 1, can not sit together, as they talk to each other all the time, distract others and misbehave.
On the other hand, if a righthanded student sits at the left end of the desk and a lefthanded student sits at the right end of the desk, they hit elbows all the time and distract each other. In other cases, the students who sit at the same desk, do not interfere with each other.
Vasily knows very well which students are lefthanders and which ones are righthanders, and he asks you to come up with any order that meets these two uncomplicated conditions (students do not talk to each other and do not bump their elbows). It is guaranteed that the input is such that at least one way to seat the students always exists. | The first input line contains a single even integer *n* (4<=≤<=*n*<=≤<=100) — the number of students in the class. The second line contains exactly *n* capital English letters "L" and "R". If the *i*-th letter at the second line equals "L", then the student number *i* is a lefthander, otherwise he is a righthander. | Print integer pairs, one pair per line. In the *i*-th line print the numbers of students that will sit at the *i*-th desk. The first number in the pair stands for the student who is sitting to the left, and the second number stands for the student who is sitting to the right. Separate the numbers in the pairs by spaces. If there are multiple solutions, print any of them. | [
"6\nLLRLLL\n",
"4\nRRLL\n"
] | [
"1 4\n2 5\n6 3\n",
"3 1\n4 2\n"
] | none | 0 | [
{
"input": "6\nLLRLLL",
"output": "1 4\n2 5\n6 3"
},
{
"input": "4\nRRLL",
"output": "3 1\n4 2"
},
{
"input": "4\nLLRR",
"output": "1 3\n2 4"
},
{
"input": "6\nRLLRRL",
"output": "1 4\n2 5\n3 6"
},
{
"input": "8\nLRLRLLLR",
"output": "1 5\n6 2\n3 7\n4 8"
},
... | 1,681,049,916 | 2,147,483,647 | PyPy 3-64 | RUNTIME_ERROR | TESTS | 0 | 77 | 2,764,800 | from sys import stdin
def input(): return stdin.readline()[:-1]
n=int(input())
s=list(input())
l=[]
r=[]
for i in range(len(s)):
if s[i]=="L":
l.append(i+1)
else:
r.append(i+1)
ans=[]
ll=len(l)
lr=len(r)
for i in range(0,min(ll,lr)):
ans.append([l[i],r[i]])
curr=i+1
if ll>=lr:
for j in range(curr,max(ll,lr),2):
ans.append([l[j],l[j+1]])
else:
for j in range(curr,max(ll,lr),2):
ans.append([r[j],r[j+1]])
for i in range(n//2):
print(ans[i][0],ans[i][1]) | Title: Lefthanders and Righthanders
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One fine October day a mathematics teacher Vasily Petrov went to a class and saw there *n* pupils who sat at the desks, two people at each desk. Vasily quickly realized that number *n* is even. Like all true mathematicians, Vasily has all students numbered from 1 to *n*.
But Vasily Petrov did not like the way the children were seated at the desks. According to him, the students whose numbers differ by 1, can not sit together, as they talk to each other all the time, distract others and misbehave.
On the other hand, if a righthanded student sits at the left end of the desk and a lefthanded student sits at the right end of the desk, they hit elbows all the time and distract each other. In other cases, the students who sit at the same desk, do not interfere with each other.
Vasily knows very well which students are lefthanders and which ones are righthanders, and he asks you to come up with any order that meets these two uncomplicated conditions (students do not talk to each other and do not bump their elbows). It is guaranteed that the input is such that at least one way to seat the students always exists.
Input Specification:
The first input line contains a single even integer *n* (4<=≤<=*n*<=≤<=100) — the number of students in the class. The second line contains exactly *n* capital English letters "L" and "R". If the *i*-th letter at the second line equals "L", then the student number *i* is a lefthander, otherwise he is a righthander.
Output Specification:
Print integer pairs, one pair per line. In the *i*-th line print the numbers of students that will sit at the *i*-th desk. The first number in the pair stands for the student who is sitting to the left, and the second number stands for the student who is sitting to the right. Separate the numbers in the pairs by spaces. If there are multiple solutions, print any of them.
Demo Input:
['6\nLLRLLL\n', '4\nRRLL\n']
Demo Output:
['1 4\n2 5\n6 3\n', '3 1\n4 2\n']
Note:
none | ```python
from sys import stdin
def input(): return stdin.readline()[:-1]
n=int(input())
s=list(input())
l=[]
r=[]
for i in range(len(s)):
if s[i]=="L":
l.append(i+1)
else:
r.append(i+1)
ans=[]
ll=len(l)
lr=len(r)
for i in range(0,min(ll,lr)):
ans.append([l[i],r[i]])
curr=i+1
if ll>=lr:
for j in range(curr,max(ll,lr),2):
ans.append([l[j],l[j+1]])
else:
for j in range(curr,max(ll,lr),2):
ans.append([r[j],r[j+1]])
for i in range(n//2):
print(ans[i][0],ans[i][1])
``` | -1 | |
625 | A | Guest From the Past | PROGRAMMING | 1,700 | [
"implementation",
"math"
] | null | null | Kolya Gerasimov loves kefir very much. He lives in year 1984 and knows all the details of buying this delicious drink. One day, as you probably know, he found himself in year 2084, and buying kefir there is much more complicated.
Kolya is hungry, so he went to the nearest milk shop. In 2084 you may buy kefir in a plastic liter bottle, that costs *a* rubles, or in glass liter bottle, that costs *b* rubles. Also, you may return empty glass bottle and get *c* (*c*<=<<=*b*) rubles back, but you cannot return plastic bottles.
Kolya has *n* rubles and he is really hungry, so he wants to drink as much kefir as possible. There were no plastic bottles in his 1984, so Kolya doesn't know how to act optimally and asks for your help. | First line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=1018) — the number of rubles Kolya has at the beginning.
Then follow three lines containing integers *a*, *b* and *c* (1<=≤<=*a*<=≤<=1018, 1<=≤<=*c*<=<<=*b*<=≤<=1018) — the cost of one plastic liter bottle, the cost of one glass liter bottle and the money one can get back by returning an empty glass bottle, respectively. | Print the only integer — maximum number of liters of kefir, that Kolya can drink. | [
"10\n11\n9\n8\n",
"10\n5\n6\n1\n"
] | [
"2\n",
"2\n"
] | In the first sample, Kolya can buy one glass bottle, then return it and buy one more glass bottle. Thus he will drink 2 liters of kefir.
In the second sample, Kolya can buy two plastic bottle and get two liters of kefir, or he can buy one liter glass bottle, then return it and buy one plastic bottle. In both cases he will drink two liters of kefir. | 750 | [
{
"input": "10\n11\n9\n8",
"output": "2"
},
{
"input": "10\n5\n6\n1",
"output": "2"
},
{
"input": "2\n2\n2\n1",
"output": "1"
},
{
"input": "10\n3\n3\n1",
"output": "4"
},
{
"input": "10\n1\n2\n1",
"output": "10"
},
{
"input": "10\n2\n3\n1",
"outpu... | 1,455,116,087 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 6 | 46 | 0 | n, a, b, c = [int(input()) for i in range(4)]
res = (n - c) // (b - c)
n -= res * (b - c)
res += n // a
print(res) | Title: Guest From the Past
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Kolya Gerasimov loves kefir very much. He lives in year 1984 and knows all the details of buying this delicious drink. One day, as you probably know, he found himself in year 2084, and buying kefir there is much more complicated.
Kolya is hungry, so he went to the nearest milk shop. In 2084 you may buy kefir in a plastic liter bottle, that costs *a* rubles, or in glass liter bottle, that costs *b* rubles. Also, you may return empty glass bottle and get *c* (*c*<=<<=*b*) rubles back, but you cannot return plastic bottles.
Kolya has *n* rubles and he is really hungry, so he wants to drink as much kefir as possible. There were no plastic bottles in his 1984, so Kolya doesn't know how to act optimally and asks for your help.
Input Specification:
First line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=1018) — the number of rubles Kolya has at the beginning.
Then follow three lines containing integers *a*, *b* and *c* (1<=≤<=*a*<=≤<=1018, 1<=≤<=*c*<=<<=*b*<=≤<=1018) — the cost of one plastic liter bottle, the cost of one glass liter bottle and the money one can get back by returning an empty glass bottle, respectively.
Output Specification:
Print the only integer — maximum number of liters of kefir, that Kolya can drink.
Demo Input:
['10\n11\n9\n8\n', '10\n5\n6\n1\n']
Demo Output:
['2\n', '2\n']
Note:
In the first sample, Kolya can buy one glass bottle, then return it and buy one more glass bottle. Thus he will drink 2 liters of kefir.
In the second sample, Kolya can buy two plastic bottle and get two liters of kefir, or he can buy one liter glass bottle, then return it and buy one plastic bottle. In both cases he will drink two liters of kefir. | ```python
n, a, b, c = [int(input()) for i in range(4)]
res = (n - c) // (b - c)
n -= res * (b - c)
res += n // a
print(res)
``` | 0 | |
879 | B | Table Tennis | PROGRAMMING | 1,200 | [
"data structures",
"implementation"
] | null | null | *n* people are standing in a line to play table tennis. At first, the first two players in the line play a game. Then the loser goes to the end of the line, and the winner plays with the next person from the line, and so on. They play until someone wins *k* games in a row. This player becomes the winner.
For each of the participants, you know the power to play table tennis, and for all players these values are different. In a game the player with greater power always wins. Determine who will be the winner. | The first line contains two integers: *n* and *k* (2<=≤<=*n*<=≤<=500, 2<=≤<=*k*<=≤<=1012) — the number of people and the number of wins.
The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=*n*) — powers of the player. It's guaranteed that this line contains a valid permutation, i.e. all *a**i* are distinct. | Output a single integer — power of the winner. | [
"2 2\n1 2\n",
"4 2\n3 1 2 4\n",
"6 2\n6 5 3 1 2 4\n",
"2 10000000000\n2 1\n"
] | [
"2 ",
"3 ",
"6 ",
"2\n"
] | Games in the second sample:
3 plays with 1. 3 wins. 1 goes to the end of the line.
3 plays with 2. 3 wins. He wins twice in a row. He becomes the winner. | 1,000 | [
{
"input": "2 2\n1 2",
"output": "2 "
},
{
"input": "4 2\n3 1 2 4",
"output": "3 "
},
{
"input": "6 2\n6 5 3 1 2 4",
"output": "6 "
},
{
"input": "2 10000000000\n2 1",
"output": "2"
},
{
"input": "4 4\n1 3 4 2",
"output": "4 "
},
{
"input": "2 21474836... | 1,572,853,413 | 2,147,483,647 | PyPy 3 | WRONG_ANSWER | TESTS | 32 | 155 | 0 | nk = input().split()
n = int(nk[0])
k = int(nk[1])
players = [int(i) for i in input().split()]
if k>n:
print(max(players))
else:
playing = players[0:2]
queue = players[2:]
win = False
wins = 0
while wins<k:
if playing[0]>playing[1]:
wins+=1
queue.append(playing[1])
playing[1] = queue.pop(0)
else:
wins=0
playing[0], playing[1] = playing[1], playing[0]
queue.append(playing[1])
playing[1] = queue.pop(0)
print(playing[0]) | Title: Table Tennis
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
*n* people are standing in a line to play table tennis. At first, the first two players in the line play a game. Then the loser goes to the end of the line, and the winner plays with the next person from the line, and so on. They play until someone wins *k* games in a row. This player becomes the winner.
For each of the participants, you know the power to play table tennis, and for all players these values are different. In a game the player with greater power always wins. Determine who will be the winner.
Input Specification:
The first line contains two integers: *n* and *k* (2<=≤<=*n*<=≤<=500, 2<=≤<=*k*<=≤<=1012) — the number of people and the number of wins.
The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=*n*) — powers of the player. It's guaranteed that this line contains a valid permutation, i.e. all *a**i* are distinct.
Output Specification:
Output a single integer — power of the winner.
Demo Input:
['2 2\n1 2\n', '4 2\n3 1 2 4\n', '6 2\n6 5 3 1 2 4\n', '2 10000000000\n2 1\n']
Demo Output:
['2 ', '3 ', '6 ', '2\n']
Note:
Games in the second sample:
3 plays with 1. 3 wins. 1 goes to the end of the line.
3 plays with 2. 3 wins. He wins twice in a row. He becomes the winner. | ```python
nk = input().split()
n = int(nk[0])
k = int(nk[1])
players = [int(i) for i in input().split()]
if k>n:
print(max(players))
else:
playing = players[0:2]
queue = players[2:]
win = False
wins = 0
while wins<k:
if playing[0]>playing[1]:
wins+=1
queue.append(playing[1])
playing[1] = queue.pop(0)
else:
wins=0
playing[0], playing[1] = playing[1], playing[0]
queue.append(playing[1])
playing[1] = queue.pop(0)
print(playing[0])
``` | 0 | |
61 | A | Ultra-Fast Mathematician | PROGRAMMING | 800 | [
"implementation"
] | A. Ultra-Fast Mathematician | 2 | 256 | Shapur was an extremely gifted student. He was great at everything including Combinatorics, Algebra, Number Theory, Geometry, Calculus, etc. He was not only smart but extraordinarily fast! He could manage to sum 1018 numbers in a single second.
One day in 230 AD Shapur was trying to find out if any one can possibly do calculations faster than him. As a result he made a very great contest and asked every one to come and take part.
In his contest he gave the contestants many different pairs of numbers. Each number is made from digits 0 or 1. The contestants should write a new number corresponding to the given pair of numbers. The rule is simple: The *i*-th digit of the answer is 1 if and only if the *i*-th digit of the two given numbers differ. In the other case the *i*-th digit of the answer is 0.
Shapur made many numbers and first tried his own speed. He saw that he can perform these operations on numbers of length ∞ (length of a number is number of digits in it) in a glance! He always gives correct answers so he expects the contestants to give correct answers, too. He is a good fellow so he won't give anyone very big numbers and he always gives one person numbers of same length.
Now you are going to take part in Shapur's contest. See if you are faster and more accurate. | There are two lines in each input. Each of them contains a single number. It is guaranteed that the numbers are made from 0 and 1 only and that their length is same. The numbers may start with 0. The length of each number doesn't exceed 100. | Write one line — the corresponding answer. Do not omit the leading 0s. | [
"1010100\n0100101\n",
"000\n111\n",
"1110\n1010\n",
"01110\n01100\n"
] | [
"1110001\n",
"111\n",
"0100\n",
"00010\n"
] | none | 500 | [
{
"input": "1010100\n0100101",
"output": "1110001"
},
{
"input": "000\n111",
"output": "111"
},
{
"input": "1110\n1010",
"output": "0100"
},
{
"input": "01110\n01100",
"output": "00010"
},
{
"input": "011101\n000001",
"output": "011100"
},
{
"input": "... | 1,586,506,647 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 2 | 93 | 0 | x = input()
x1 = input()
s=""
for i in range(len(x)):
if x[i]==x1[i]:
s+='0'
else:
s+='1'
print(int(s)) | Title: Ultra-Fast Mathematician
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Shapur was an extremely gifted student. He was great at everything including Combinatorics, Algebra, Number Theory, Geometry, Calculus, etc. He was not only smart but extraordinarily fast! He could manage to sum 1018 numbers in a single second.
One day in 230 AD Shapur was trying to find out if any one can possibly do calculations faster than him. As a result he made a very great contest and asked every one to come and take part.
In his contest he gave the contestants many different pairs of numbers. Each number is made from digits 0 or 1. The contestants should write a new number corresponding to the given pair of numbers. The rule is simple: The *i*-th digit of the answer is 1 if and only if the *i*-th digit of the two given numbers differ. In the other case the *i*-th digit of the answer is 0.
Shapur made many numbers and first tried his own speed. He saw that he can perform these operations on numbers of length ∞ (length of a number is number of digits in it) in a glance! He always gives correct answers so he expects the contestants to give correct answers, too. He is a good fellow so he won't give anyone very big numbers and he always gives one person numbers of same length.
Now you are going to take part in Shapur's contest. See if you are faster and more accurate.
Input Specification:
There are two lines in each input. Each of them contains a single number. It is guaranteed that the numbers are made from 0 and 1 only and that their length is same. The numbers may start with 0. The length of each number doesn't exceed 100.
Output Specification:
Write one line — the corresponding answer. Do not omit the leading 0s.
Demo Input:
['1010100\n0100101\n', '000\n111\n', '1110\n1010\n', '01110\n01100\n']
Demo Output:
['1110001\n', '111\n', '0100\n', '00010\n']
Note:
none | ```python
x = input()
x1 = input()
s=""
for i in range(len(x)):
if x[i]==x1[i]:
s+='0'
else:
s+='1'
print(int(s))
``` | 0 |
748 | A | Santa Claus and a Place in a Class | PROGRAMMING | 800 | [
"implementation",
"math"
] | null | null | Santa Claus is the first who came to the Christmas Olympiad, and he is going to be the first to take his place at a desk! In the classroom there are *n* lanes of *m* desks each, and there are two working places at each of the desks. The lanes are numbered from 1 to *n* from the left to the right, the desks in a lane are numbered from 1 to *m* starting from the blackboard. Note that the lanes go perpendicularly to the blackboard, not along it (see picture).
The organizers numbered all the working places from 1 to 2*nm*. The places are numbered by lanes (i. e. all the places of the first lane go first, then all the places of the second lane, and so on), in a lane the places are numbered starting from the nearest to the blackboard (i. e. from the first desk in the lane), at each desk, the place on the left is numbered before the place on the right.
Santa Clause knows that his place has number *k*. Help him to determine at which lane at which desk he should sit, and whether his place is on the left or on the right! | The only line contains three integers *n*, *m* and *k* (1<=≤<=*n*,<=*m*<=≤<=10<=000, 1<=≤<=*k*<=≤<=2*nm*) — the number of lanes, the number of desks in each lane and the number of Santa Claus' place. | Print two integers: the number of lane *r*, the number of desk *d*, and a character *s*, which stands for the side of the desk Santa Claus. The character *s* should be "L", if Santa Clause should sit on the left, and "R" if his place is on the right. | [
"4 3 9\n",
"4 3 24\n",
"2 4 4\n"
] | [
"2 2 L\n",
"4 3 R\n",
"1 2 R\n"
] | The first and the second samples are shown on the picture. The green place corresponds to Santa Claus' place in the first example, the blue place corresponds to Santa Claus' place in the second example.
In the third sample there are two lanes with four desks in each, and Santa Claus has the fourth place. Thus, his place is in the first lane at the second desk on the right. | 500 | [
{
"input": "4 3 9",
"output": "2 2 L"
},
{
"input": "4 3 24",
"output": "4 3 R"
},
{
"input": "2 4 4",
"output": "1 2 R"
},
{
"input": "3 10 24",
"output": "2 2 R"
},
{
"input": "10 3 59",
"output": "10 3 L"
},
{
"input": "10000 10000 160845880",
"... | 1,482,657,367 | 667 | Python 3 | OK | TESTS | 46 | 77 | 4,608,000 | n,m,k=[int(i) for i in input().split()]
ryad=k//(2*m)+1
if k%(2*m)==0:
ryad-=1
parta=(k-2*m*(ryad-1))//2+k%2
if k%2==0:
mesto='R'
else:
mesto='L'
print(ryad,parta,mesto) | Title: Santa Claus and a Place in a Class
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Santa Claus is the first who came to the Christmas Olympiad, and he is going to be the first to take his place at a desk! In the classroom there are *n* lanes of *m* desks each, and there are two working places at each of the desks. The lanes are numbered from 1 to *n* from the left to the right, the desks in a lane are numbered from 1 to *m* starting from the blackboard. Note that the lanes go perpendicularly to the blackboard, not along it (see picture).
The organizers numbered all the working places from 1 to 2*nm*. The places are numbered by lanes (i. e. all the places of the first lane go first, then all the places of the second lane, and so on), in a lane the places are numbered starting from the nearest to the blackboard (i. e. from the first desk in the lane), at each desk, the place on the left is numbered before the place on the right.
Santa Clause knows that his place has number *k*. Help him to determine at which lane at which desk he should sit, and whether his place is on the left or on the right!
Input Specification:
The only line contains three integers *n*, *m* and *k* (1<=≤<=*n*,<=*m*<=≤<=10<=000, 1<=≤<=*k*<=≤<=2*nm*) — the number of lanes, the number of desks in each lane and the number of Santa Claus' place.
Output Specification:
Print two integers: the number of lane *r*, the number of desk *d*, and a character *s*, which stands for the side of the desk Santa Claus. The character *s* should be "L", if Santa Clause should sit on the left, and "R" if his place is on the right.
Demo Input:
['4 3 9\n', '4 3 24\n', '2 4 4\n']
Demo Output:
['2 2 L\n', '4 3 R\n', '1 2 R\n']
Note:
The first and the second samples are shown on the picture. The green place corresponds to Santa Claus' place in the first example, the blue place corresponds to Santa Claus' place in the second example.
In the third sample there are two lanes with four desks in each, and Santa Claus has the fourth place. Thus, his place is in the first lane at the second desk on the right. | ```python
n,m,k=[int(i) for i in input().split()]
ryad=k//(2*m)+1
if k%(2*m)==0:
ryad-=1
parta=(k-2*m*(ryad-1))//2+k%2
if k%2==0:
mesto='R'
else:
mesto='L'
print(ryad,parta,mesto)
``` | 3 |
Subsets and Splits
Successful Python Submissions
Retrieves all records from the train dataset where the verdict is 'OK', providing basic filtering but limited analytical value.
SQL Console for MatrixStudio/Codeforces-Python-Submissions
Retrieves records of users with a rating of 1600 or higher and a verdict of 'OK', providing basic filtering but limited analytical value.
SQL Console for MatrixStudio/Codeforces-Python-Submissions
Counts the number of entries with a rating above 2000 and a verdict of 'OK', providing basic filtering but limited analytical value.
SQL Console for MatrixStudio/Codeforces-Python-Submissions
Counts the number of entries with a 'OK' verdict, providing a basic overview of a specific category within the dataset.