image imagewidth (px) 205 980 | latex stringlengths 132 39.9k | filename stringlengths 18 19 |
|---|---|---|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Name} & \textbf{Description} \\
\hline
C2 & complement component 2 \\
\hline
PMP22 & peripheral myelin protein 22 \\
\hline
SDC1 & syndecan 1 \\
\hline
COL11A1 & collagen, type XI, alpha 1 \\
\hline
ITGB4 & integrin, beta 4 \\
\hline
DCN & decorin \\
\hline
THBS4 & thrombospondin 4 \\
\hline
COL1A1 & collagen, type I, alpha 1 \\
\hline
IFIT1 & interferon-induced protein with tetratricopeptide repeats 1 \\
\hline
LUM & lumican \\
\hline
MMP9 & matrix metalloproteinase 9 \\
\hline
COL3A1 & collagen, type III, alpha 1 \\
\hline
COL1A2 & collagen, type I, alpha 2 \\
\hline
JAK1 & Janus kinase 1 \\
\hline
MMP12 & matrix metalloproteinase 12 \\
\hline
TNFSF10 & tumour necrosis factor (ligand) superfamily, member 10 \\
\hline
HSPA4 & heat shock 70 kDa protein 4 \\
\hline
FBLN2 & fi bulin 2 \\
\hline
SFRP2 & secreted frizzled-related protein 2 \\
\hline
COL15A1 & collagen, type XV, alpha 1 \\
\hline
FBLN1 & fi bulin-1 \\
\hline
GEM & GTP binding protein \\
\hline
MATN2 & matrilin 2 \\
\hline
CCL21 & chemokine (C-C motif) ligand 21 \\
\hline
CCL19 & chemokine (C-C motif) ligand 19 \\
\hline
SLCO2A1 & solute carrier organic anion transporter family, member 2A1 \\
\hline
MFAP5 & microfi brillar-associated protein 5 \\
\hline
CXCL14 & chemokine (C-X-C motif) ligand 14 \\
\hline
PRG4 & proteoglycan 4 \\
\hline
CCL13 & chemokine (C-C motif) ligand 13 \\
\hline
CCL14 & chemokine (C-C motif) ligand 14 \\
\hline
CCL15 & chemokine (C-C motif) ligand 15 \\
\hline
\end{tabular}
\end{table} | PMC2716678_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
& \textbf{True normal tissues} & \textbf{True tumor tissues} \\
\hline
Predicted as normal tissues & 1 & 1 \\
\hline
Predicted as tumor tissues & 5 & 41 \\
\hline
\end{tabular}
\end{table} | PMC2716681_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& & Batch I Analysis \\
\hline
& Organ donor (N) & Adjacent to tumor (A) & Tumor (T) & Total \\
\hline
Liver & 21 & 30 & 43 & 94 \\
\hline
Prostate & 23 & 59 & 66 & 148 \\
\hline
& & Batch II Analysis \\
\hline
& Organ donor (N) & Tumor (T) & & Total \\
\hline
Liver & 21 & 43 & & 64 \\
\hline
Prostate & 23 & 66 & & 89 \\
\hline
Lung & 17 & 134 & & 151 \\
\hline
Bladder & 5 & 57 & & 62 \\
\hline
\end{tabular}
\end{table} | PMC2716681_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{Liver vs. Prostate} \\
\hline
& liv→liv & pro→liv & pro→pro & liv→pro \\
\hline
All genes & 96.5\% & 66.3\% & 93.9\% & 47.4\% \\
\hline
Common signature & 96.5\% & 93.0\% & 98.8\% & 96.3\% \\
\hline
& \multicolumn{2}{c|}{Liver vs. Prostate} \\
\hline
All genes & 92.6\% & 77.9\% & 96.6\% & 54.6\% \\
\hline
Common signature & 98.2\% & 96.0\% & 98.3\% & 96.6\% \\
\hline
& \multicolumn{2}{c|}{Liver vs. Prostate} \\
\hline
All genes & 79.9\% & 51.9\% & 71.4\% & 55.7\% \\
\hline
Common signature & 75.6\% & 74.7\% & 66.7\% & 65.1\% \\
\hline
\end{tabular}
\end{table} | PMC2716681_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{Liver} \\
\hline
& liv→liv & pro→liv & pro→pro & liv→pro \\
\hline
All genes & 96.51\% & 66.28\% & 93.94\% & 47.36\% \\
\hline
Common signature & 97.67\% & 97.67\% & 95.55\% & 94.14\% \\
\hline
& \multicolumn{2}{c|}{Liver} \\
\hline
& liv→liv & lun→liv & lun→lun & liv→lun \\
\hline
All genes & 96.51\% & 56.98\% & 90.72\% & 45.32\% \\
\hline
Common signature & 95.23\% & 93.02\% & 95.94\% & 94.72\% \\
\hline
& \multicolumn{2}{c|}{Lung} \\
\hline
& lun→lun & pro→lun & pro→pro & lun→pro \\
\hline
All genes & 90.72\% & 69.03\% & 93.94\% & 62.88\% \\
\hline
Common signature & 94.82\% & 94.45\% & 79.61\% & 72.76\% \\
\hline
& \multicolumn{2}{c|}{Liver} \\
\hline
& liv→liv & bla→liv & bla→bla & liv→bla \\
\hline
All genes & 96.51\% & 62.79\% & 88.60\% & 49.65\% \\
\hline
Common signature & 91.74\% & 91.86\% & 98.25\% & 98.25\% \\
\hline
& \multicolumn{2}{c|}{Prostate} \\
\hline
& pro→pro & bla→pro & bla→bla & pro→bla \\
\hline
All genes & 93.94\% & 36.30\% & 88.60\% & 42.63\% \\
\hline
Common signature & 92.92\% & 86.86\% & 97.81\% & 88.25\% \\
\hline
& \multicolumn{2}{c|}{Lung} \\
\hline
& lun→lun & bla→lun & bla→bla & lun→bla \\
\hline
All genes & 90.72\% & 51.87\% & 88.60\% & 50.88\% \\
\hline
Common signature & 89.38\% & 85.91\% & 97.37\% & 85.61\% \\
\hline
\end{tabular}
\end{table} | PMC2716681_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& & \multicolumn{4}{c|}{\textbf{Test data}} \\
\hline
& & \textbf{Liver} & \textbf{Prostate} & \textbf{Lung} & \textbf{Bladder} \\
\hline
\multirow{4}{*}{Training data} & \textbf{Liver} & 96.5\% (69)* & (225)+ 94.1\% & (119)+ 94.7\% & (53)+ 98.3\% \\
\hline
\textbf{Prostate} & (225)+ 97.7\% & 93.9\% (55)* & (288)+ 94.5\% & (10)+ 88.3\% \\
\hline
\textbf{Lung} & (119)+ 93.0\% & (288)+ 72.8\% & 90.7\% (57)* & (19)+ 85.6\% \\
\hline
\textbf{Bladder} & (53)+ 91.9\% & (10)+ 86.9\% & (19)+ 85.9\% & 88.6\% (135)* \\
\hline
\end{tabular}
\end{table} | PMC2716681_table_4 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{A2780}} & \multicolumn{2}{c|}{\textbf{A2780}/CDDP} & \multicolumn{2}{c|}{\textbf{SKOV3}} \\
\hline
& \textbf{\textbf{\textbf{control}}} & \textbf{\textbf{\textbf{BRCA1 si}}} & \textbf{\textbf{\textbf{control}}} & \textbf{\textbf{\textbf{BRCA1 si}}} & \textbf{\textbf{\textbf{control}}} & \textbf{\textbf{\textbf{BRCA1 si}}} \\
\hline
G1 & 52.57$\pm$5.11\% & 50.03$\pm$4.88\% & 48.87$\pm$4.76\% & 44.77$\pm$5.71\% & 45.07$\pm$4.1\% & 43.03$\pm$2.71\% \\
\hline
S & 16.43$\pm$3.18\% & 19.33$\pm$2.81\% & 10.89$\pm$2.18\% & 10.40$\pm$3.23\% & 9.43$\pm$5.18\% & 9.39$\pm$1.86\% \\
\hline
G2/M & 19.73$\pm$2.50\% & 21.37$\pm$2.76\% & 28.83$\pm$2.44\% & 29.39$\pm$3.50\% & 23.03$\pm$1.50\% & 23.99$\pm$2.90\% \\
\hline
\end{tabular}
\end{table} | PMC2716781_table_0 | |
\begi\textbf{n}{table}
\ce\textbf{n}teri\textbf{n}g
\label{tab:tablelabel}
\begi\textbf{n}{tabular}{|l|l|l|l|l|l|}
\hli\textbf{n}e
\textbf{Group} & \textbf{Site} & \textbf{n} & Wome\textbf{n}/Me\textbf{n} & \textbf{Age (years)} & \textbf{BMI (kg/m2)} \\
\hli\textbf{n}e
\multirow{4}{*}{Co\textbf{n}trol} & UK & 21 & 20/1 & 40.5 $\pm$ 11.0 & 25.4 $\pm$ 3.8 \\
\hli\textbf{n}e
Australia & 16 & 12/4 & 44.5 $\pm$ 12.1 & 24.3 $\pm$ 5.1 \\
\hli\textbf{n}e
Spai\textbf{n} & 23 & 17/6 & 38.5 $\pm$ 11.1 & 23.0 $\pm$ 2.6 \\
\hli\textbf{n}e
Total & 60 & 49/11 & 40.8 $\pm$ 11.4 & 24.2 $\pm$ 3.8 \\
\hli\textbf{n}e
\multirow{4}{*}{Routes} & UK & 21 & 19/2 & 43.8 $\pm$ 10.2 & 25.2 $\pm$ 4.1 \\
\hli\textbf{n}e
Australia & 19 & 13/6 & 43.3 $\pm$ 10.0 & 26.7 $\pm$ 4.4 \\
\hli\textbf{n}e
Spai\textbf{n} & 20 & 13/7 & 39.4 $\pm$ 7.0 & 23.5 $\pm$ 2.8 \\
\hli\textbf{n}e
Total & 60 & 45/15 & 42.1 $\pm$ 9.2 & 25.1 $\pm$ 4.0 \\
\hli\textbf{n}e
\multirow{4}{*}{I\textbf{n}cide\textbf{n}tal} & UK & 21 & 18/3 & 39.8 $\pm$ 10.4 & 25.1 $\pm$ 3.4 \\
\hli\textbf{n}e
Australia & 14 & 11/3 & 43.2 $\pm$ 10.3 & 28.1 $\pm$ 6.0 \\
\hli\textbf{n}e
Spai\textbf{n} & 24 & 18/6 & 40.8 $\pm$ 8.9 & 24.0 $\pm$ 3.1 \\
\hli\textbf{n}e
Total & 59 & 4712 & 41.0 $\pm$ 9.7 & 25.4 $\pm$ 4.3 \\
\hli\textbf{n}e
\e\textbf{n}d{tabular}
\e\textbf{n}d{table} | PMC2717045_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{5}{c|}{\textbf{Risk groups}} \\
\hline
\textbf{Country} & \textbf{MSM} & \textbf{IDUs} & \textbf{Heterosexuals} & \textbf{Others} & \textbf{Unknown} & \textbf{Sum} \\
\hline
United Kingdom (GBR) & 59 (66\%) & 0 (0\%) & 6 (7\%) & 0 (0\%) & 25 (28\%) & 90 \\
\hline
Austria (AUT) & 18 (20\%) & 5(6\%) & 7 (8\%) & 0 (0\%) & 60 (67\%) & 90 \\
\hline
Belgium (BEL) & 56 (65\%) & 3 (3\%) & 11 (13\%) & 4 (5\%) & 12 (14\%) & 86 \\
\hline
Denmark (DNK) & 15 (17\%) & 4 (4\%) & 7 (8\%) & 0 (0\%) & 64 (71\%) & 90 \\
\hline
Spain (ESP) & 46 (51\%) & 21 (23\%) & 17 (19\%) & 0 (0\%) & 6 (7\%) & 90 \\
\hline
Germany (DEU) & 85 (94\%) & 0 (0\%) & (0\%) & 0 (0\%) & 5 (6\%) & 90 \\
\hline
Greece (GRC) & 39 (53\%) & 3 (4\%) & 8 (11\%) & 1 (1\%) & 22 (30\%) & 73 \\
\hline
Israel (ISR) & 15 (44\%) & 8 (24\%) & 7 (21\%) & 1 (3\%) & 3 (9\%) & 34 \\
\hline
Italy (ITA) & 31 (34\%) & 15 (17\%) & 32 (36\%) & 0 (0\%) & 12 (13\%) & 90 \\
\hline
Luxembourg (LUX) & 50 (56\%) & 15 (17\%) & 19 (21\%) & 0 (0\%) & 6 (7\%) & 90 \\
\hline
Netherlands (NLD) & 57 (68\%) & 7 (8\%) & 15 (18\%) & 0 (0\%) & 5 (6\%) & 84 \\
\hline
Norway (NOR) & 19 (73\%) & 1 (4\%) & 5 (19\%) & 0 (0\%) & 1 (4\%) & 26 \\
\hline
Poland (POL) & 12 (13\%) & 42 (47\%) & 19 (21\%) & 0 (0\%) & 17 (19\%) & 90 \\
\hline
Portugal (PRT) & 27 (30\%) & 16 (18\%) & 35 (39\%) & 0 (0\%) & 12 (13\%) & 90 \\
\hline
Serbia & 22 (50\%) & 6 (14\% & 16 (36\%) & 0 (0\%) & 0 (0\%) & 44 \\
\hline
Sweden (SWE) & 44 (49\%) & 3 (3\%) & 10 (11\%) & 0 (0\%) & 33 (37\%) & 90 \\
\hline
Switzerland (CHE) & 48 (53\%) & 10 (11\%) & 28 (31\%) & 0 (0\%) & 4 (4\%) & 90 \\
\hline
\textbf{Sum} & 643 (48\%) & 159 (12\%) & 242 (18\%) & 6 (0.5\%) & 287 (21\%) & 1337 \\
\hline
\end{tabular}
\end{table} | PMC2717046_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{White (291)} & \textbf{Hispanic (22)} & \textbf{Black (12)} & \textbf{Asian (5)} & \textbf{Other (15)} \\
\hline
SNAP & 0.709 & 0.750 & 1.240 & 0.818 & 0.659 \\
\hline
PAML & 0.839 & 0.826 & 1.411 & 1.346 & 0.751 \\
\hline
HYPHY & 0.949 & 0.729 & 1.453 & 0.720 & 1.202 \\
\hline
\end{tabular}
\end{table} | PMC2717047_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Race}} & \multicolumn{2}{c|}{\textbf{Race} by treatment} \\
\hline
\textbf{Method} & \textbf{\textbf{ANOVA}} & \textbf{Corrected pairwise t-tests} & \textbf{\textbf{ANOVA}} & \textbf{lm coefficient} \\
\hline
SNAP & (0.011) & black vs hispanic (0.020) black vs other (0.013) black vs white (0.004) & (0.025) & black placebo (0.001) \\
\hline
PAML & (0.019) & black vs hispanic (0.047) black vs other (0.047) black vs white (0.033) & & black placebo (0.016) \\
\hline
HYPHY & & & & black placebo (0.015) \\
\hline
\end{tabular}
\end{table} | PMC2717047_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Analyte} & \textbf{Collision energy (eV)} & \textbf{Collision exit potential (V)} & \textbf{Declustering potential (V)} & \textbf{Entrance potential (V)} \\
\hline
myo-inositol & -10.0 & -5.0 & -70.0 & -10.0 \\
\hline
[2H6]-myo-inositol & -18.0 & -9.0 & -70.0 & -10.0 \\
\hline
\end{tabular}
\end{table} | PMC2717050_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Time} & \textbf{Mean} & \textbf{SD} & \textbf{N} \\
\hline
1 & 6.33 & 4.1 & 45 \\
\hline
2 & 3.16 & 3.9 & 32 \\
\hline
3 & 0.88 & 2.47 & 17 \\
\hline
\end{tabular}
\end{table} | PMC2717051_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
& \multirow{2}{*}{\textbf{Time 1 Mean}} & \multirow{2}{*}{\textbf{\textbf{\textbf{SD}}}} & \multirow{2}{*}{\textbf{\textbf{\textbf{N}}}} & \multirow{2}{*}{\textbf{Time 2 Mean}} & \multirow{2}{*}{\textbf{\textbf{\textbf{SD}}}} & \multirow{2}{*}{\textbf{\textbf{\textbf{N}}}} & \multirow{2}{*}{\textbf{Time 3 Mean}} & \multirow{2}{*}{\textbf{\textbf{\textbf{SD}}}} & \multirow{2}{*}{\textbf{\textbf{\textbf{N}}}} \\
\hline
\\
\hline
Total Difficulties & 20.15 & 5.19 & 46 & 17.41 & 6.31 & 32 & 15.06 & 8.36 & 17 \\
\hline
Pro-Social Behaviour & 6.09 & 2.3 & 46 & 6.38 & 2.67 & 32 & 6.2 & 3.22 & 17 \\
\hline
Hyperactivity & 5.8 & 2.19 & 46 & 5.44 & 2.42 & 32 & 4.71 & 2.73 & 17 \\
\hline
Conduct Problems & 4 & 2.07 & 46 & 3.69 & 2.15 & 32 & 2.76 & 2.44 & 17 \\
\hline
Emotional Difficulties & 6.93 & 1.89 & 46 & 5.63 & 2.86 & 32 & 4.88 & 2.96 & 17 \\
\hline
Peer Problems & 3.41 & 2.15 & 46 & 2.66 & 2.35 & 32 & 2.53 & 2.24 & 17 \\
\hline
\end{tabular}
\end{table} | PMC2717051_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Time} & \textbf{Mean} & \textbf{SD} & \textbf{N} \\
\hline
1 & 12.13 & 3.21 & 45 \\
\hline
2 & 13.48 & 3.48 & 31 \\
\hline
3 & 15 & 3.48 & 17 \\
\hline
\end{tabular}
\end{table} | PMC2717051_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
& \multirow{2}{*}{\textbf{Time 1 Mean}} & \multirow{2}{*}{\textbf{\textbf{\textbf{SD}}}} & \multirow{2}{*}{\textbf{\textbf{\textbf{N}}}} & \multirow{2}{*}{\textbf{Time 2 Mean}} & \multirow{2}{*}{\textbf{\textbf{\textbf{SD}}}} & \multirow{2}{*}{\textbf{\textbf{\textbf{N}}}} & \multirow{2}{*}{\textbf{Time 3 Mean}} & \multirow{2}{*}{\textbf{\textbf{\textbf{SD}}}} & \multirow{2}{*}{\textbf{\textbf{\textbf{N}}}} \\
\hline
\\
\hline
Challenges & 12.76 & 3.84 & 46 & 8.88 & 3.95 & 24 & 6.65 & 3.82 & 13 \\
\hline
Goals & 6.14 & 2.93 & 46 & 10.66 & 4.18 & 22 & 11.35 & 4.65 & 13 \\
\hline
\end{tabular}
\end{table} | PMC2717051_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Parameters} & \textbf{Oromo folksongs} & \textbf{Remark} \\
\hline
Lyrics & More than one issue is addressed & With the exception to some of the folksongs, most of them describe various and more than one issues \\
\hline
Vocal style & Less ornamental to ornamental & Sometimes melismatic or strophic forms exist \\
\hline
Timber & Soft to less harsh & Occasionally strident and forced singing \\
\hline
Performer arrangement & Responsorial-leader chorus alternation is the dominant one & At times chorus-chorus alternation style. Responsorial- leader chorus alternation of male songs is less often followed by acclamation of women group. Few Solo songs exist. \\
\hline
Melody & Have a narrow range up to a fifth interval; melodies are patterned in descending and ascending order; 2 or three melodies are used & The melodic form of the folksong is strophic consisting of two to eight lines. The relationships among the lines do vary or are similar. Some of the folksongs have similar or different content. Most of the folk songs are monophonic and some are polyphonic (more than one melodic line). Most of the songs listed here for describing the bioecocultural heritages are sung without accompaniment of instruments and hence are predominantly vocal folksongs. \\
\hline
Scale & Major; natural minor; pentatonic major & Most of the folksongs collected here are diatonic or pentatonic or prepentatonic \\
\hline
Rhythm & Hard to identify; not a major element; 3/4 or 6/8 & The rhythm and metre are not similar throughout the folksongs described. Mostly they are non-metric as they are mostly vocal. The music has been described as primarily melodic with simple rhythmic accompaniments that can be similar or different. \\
\hline
Song type & Both secular and sacred & Folksongs are impulsive creations which are not developed by artists in organized ways hence can have various foci. \\
\hline
Qñt* & Tzta and Bati & Most of the folksongs are composed without notations. It might be the same composer or different who created both the words and the music. One of the major classes of the folksongs, the ballads are narrative songs for describing varieties which are identified by their texts. The instrumental folksongs commonly accompanied by drums in the region are used for dances. \\
\hline
\end{tabular}
\end{table} | PMC2717052_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Patient characteristics} & \textbf{Number of patients} & \textbf{HER 2 +(\%)} \\
\hline
Total Patients & 73 & 21 (28.8) \\
\hline
Sex \\
\hline
Male & 69 & 19 (27.5) \\
\hline
Female & 4 & 2 (50) \\
\hline
Stage \\
\hline
Stage IIIB & 30 & 9 (30) \\
\hline
Stage IV & 43 & 12 (27.9) \\
\hline
Histopathology \\
\hline
Adenocarcinoma & 27 & 11 (40.7) \\
\hline
Squamous cell (Epidermoid) & 34 & 5 (14.7) \\
\hline
Not otherwise specified (NOS) & 12 & 5 (41.6) \\
\hline
\end{tabular}
\end{table} | PMC2717055_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{HER 2} & \textbf{CR+PR+SD} & \textbf{PD} \\
\hline
\textbf{HER 2} (+) & 13 (63.9) & 8(38.1\%) \\
\hline
\textbf{HER 2} (-) & 48 (92.3\%) & 4(7.7\%) \\
\hline
\end{tabular}
\end{table} | PMC2717055_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Patient characteristics} & \textbf{Number of patients} & \textbf{CR+PR+SD} & \textbf{PD} \\
\hline
Total Patients & 73 & 61(83.6\%) & 12 (16.4\%) \\
\hline
Sex \\
\hline
Male & 69 & 58 (84\%) & 11 (16\%) \\
\hline
Female & 4 & 3(75\%) & 1 (25\%) \\
\hline
Stage \\
\hline
Stage IIIB & 30 & 29(96.6\%) & 1(3.4\%) \\
\hline
Stage IV & 43 & 32 (74.4\%) & 11 (25.6\%) \\
\hline
Histopathology \\
\hline
Adenocarcinoma & 27 & 21(78\%) & 6(22\%) \\
\hline
Squamous cell (Epidermoid) & 34 & 31(91.2\%) & 3 (8.8\%) \\
\hline
Not otherwise specified (NOS) & 12 & 9 (75\%) & 3 (25\%) \\
\hline
\end{tabular}
\end{table} | PMC2717055_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{GO term} & \textbf{Level1} & \textbf{Genes2} & \textbf{ORFs3} & \textbf{Prot. DIP4} & \textbf{Prot.DIP/ ORFs (\%)} & \textbf{Prot. GOLD5} & \textbf{Prot.GOLD/ ORFs (\%)} \\
\hline
Developmental process (BP) & 1 & 768 & 757 & 632 & 83.5\% & 257 & 34.0\% \\
\hline
Reproduction (BP) & 1 & 299 & 298 & 245 & 82.2\% & 111 & 37.3\% \\
\hline
Establishment of cellular localization (BP) & 1 & 573 & 568 & 452 & 79.6\% & 188 & 33.1\% \\
\hline
Response to stimulus (BP) & 1 & 670 & 657 & 514 & 78.2\% & 207 & 31.5\% \\
\hline
Ribonucleoprotein complex (CC) & 2 & 556 & 459 & 318 & 69.3\% & 96 & 20.9\% \\
\hline
Organelle envelope (CC) & 2 & 346 & 345 & 230 & 66.7\% & 69 & 20.0\% \\
\hline
Transcription regulator activity (MF) & 1 & 307 & 303 & 276 & 91.1\% & 107 & 35.3\% \\
\hline
Structural molecule activity (MF) & 1 & 307 & 286 & 231 & 80.8\% & 75 & 26.2\% \\
\hline
\multirow{2}{*}{Transporter activity (MF)} & 1 & 380 & 377 & 297 & 78.8\% & 63 & 16.7\% \\
\hline
& & & & Average: 78.9\% & & Average: 28.3\% \\
\hline
\end{tabular}
\end{table} | PMC2717056_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
GO term & N (P) DIP & N (P) GOLD & GO term & N (P) DIP & N (P) GOLD \\
\hline
Developmental process (32502) & 632 (16) & 257 (8) & Organelle envelope (31967) & 230 (12) & 69 (2) \\
\hline
Reproductive developmental process (3006) & 26 (0) & 13 (0) & Organelle inner membrane (19866) & 105 (8) & 27 (2) \\
\hline
Anatomical structure development (48856) & 186 (15) & 94 (8) & Organelle outer membrane (31968) & 24 (0) & --- \\
\hline
Cellular developmental process (48869) & 450 (1) & 169 (0) & Organelle envelope lumen (31970) & 25 (0) & --- \\
\hline
\multirow{2}{*}{Aging (7568)} & 40 (0) & 22 (0) & Nuclear envelope (5635) & 86 (3) & 35 (0) \\
\hline
& & Mitochondrial envelope (5740) & 148 (9) & 34 (2) \\
\hline
Reproduction (3) & 245 (7) & 111 (4) \\
\hline
Sexual reproduction (19953) & 95 (0) & 41 (0) & Transcription regulator activity (30528) & 276 (14) & 107 (5) \\
\hline
Asexual reproduction (19954) & 74 (6) & 44 (4) & Transcriptional activator activity (16563) & 50 (0) & 24 (0) \\
\hline
Reproductive process (22414) & 207 (7) & 88 (4) & Transcriptional repressor activity (16564) & 35 (2) & 13 (1) \\
\hline
\multirow{2}{*}{Rep. of a single-celled organism (32505)} & 220 (7) & 99 (4) & Transcription factor activity (3700) & 45 (2) & 13 (1) \\
\hline
& & RNA polymerase II transcription factor activity (3702) & 112 (4) & 44 (1) \\
\hline
Establishment of cellular localization (51649) & 452 (21) & 188 (10) & Transcriptional elongation regulator activity (3711) & 14 (6) & --- \\
\hline
Secretion by cell (32940) & 206 (9) & 84 (3) & Transcription cofactor activity (3712) & 36 (1) & 16 (0) \\
\hline
Establishment of nucleus localization (40023) & 17 (0) & --- \\
\hline
\multirow{2}{*}{Intracellular transport (46907)} & 409 (21) & 175 (10) & Structural molecule activity (5198) & 231 (29) & 75 (18) \\
\hline
& & Structural constituent of ribosome (3735) & 115 (0) & 21 (0) \\
\hline
Response to stimulus (50896) & 514 (3) & 207 (0) & Structural constituent of cytoskeleton (5200) & 50 (29) & 31 (18) \\
\hline
Response to endogenous stimulus (9719) & 197 (3) & 101 (0) \\
\hline
Cellular response to stimulus (51716) & 13 (0) & --- & Transporter Activity (5215) & 297 (8) & 63 (1) \\
\hline
Response to abiotic stimulus (9628) & 83 (0) & 32 (0) & Ion transport activity (15075) & 111 (5) & 16 (0) \\
\hline
Response to external stimulus (9605) & 27 (0) & 13 (0) & Carbohydrate transporter activity (15144) & 26 (0) & --- \\
\hline
Response to biotic stimulus (6907) & 19 (0) & --- & ATPase activity, coupled to movement of substances (43492) & 41 (2) & --- \\
\hline
Response to chemical stimulus (42221) & 212 (0) & 65 (0) & Amine transporter activity (5275) & 27 (0) & --- \\
\hline
\multirow{2}{*}{Response to stress (6950)} & 370 (3) & 159 (0) & Organic acid transporter activity (5342) & 32 (0) & --- \\
\hline
& & Carrier activity (5386) & 67 (0) & 13 (0) \\
\hline
Ribonucleoprotein complex (30529) & 318 (64) & 96 (12) & Intracellular transporter activity (5478) & 28 (0) & 17 (0) \\
\hline
Small nuclear ribonucleoprotein complex (30532) & 58 (2) & 24 (0) & Protein transporter activity (8565) & 48 (1) & 29 (1) \\
\hline
Preribosome (30684) & 12 (4) & --- & Lipid transporter activity (5319) & 11(2) & --- \\
\hline
Spliceosome (5681) & 74 (12) & 33 (2) \\
\hline
Small nucleolar ribonucleoprotein complex (5732) & 49 (43) & 10 (9) \\
\hline
Ribosome (5840) & 156 (5) & 45 (1) \\
\hline
Polysome (5844) & 11 (0) & --- \\
\hline
\end{tabular}
\end{table} | PMC2717056_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{GO TERMS} & \textbf{Coverage} & \textbf{Purity (Average)} & \textbf{Ambiguity} & \textbf{Φ(average $\pm$ s.e.m.)} \\
\hline
Developmental process (32502) & 63.6\% (402/632) & 62.2\% & 13.0\% (74/570) & 0.46 $\pm$ 0.02 \\
\hline
Reproduction (3) & 58.4\% (142/245) & 94.1\% & 0\% (0/25) & 0.38 $\pm$ 0.11 \\
\hline
Establishment of cellular localization (51649) & 66.8\% (302/452) & 88.4\% & 1.1\% (3/264) & 0.43 $\pm$ 0.10 \\
\hline
Response to stimulus (50896) & 56.4\% (290/514) & 77.5\% & 19.5\% (32/164) & 0.46 $\pm$ 0.05 \\
\hline
Ribonucleoprotein complex (30529) & 59.7\% (190/318) & 77.8\% & 12.8\% (31/242) & 0.64 $\pm$ 0.06 \\
\hline
Organelle envelope (31967) & 39.6\% (91/230) & 84.9\% & 1.2\% (1/83) & 0.47 $\pm$ 0.09 \\
\hline
Transcription regulator activity (30528) & 43.5\% (120/276) & 67.6\% & 15.0\% (30/200) & 0.40 $\pm$ 0.08 \\
\hline
Structural molecule activity (5198) & 39.8\% (92/231) & 95.6\% & 0\% (0/165) & 0.53 \\
\hline
Transporter Activity (5215) & 33.7\% (100/297) & 72.5\% & 6.4\% (12/186) & 0.43 $\pm$ 0.06 \\
\hline
\end{tabular}
\end{table} | PMC2717056_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{GO TERMS} & \textbf{Coverage} & \textbf{Purity (Average)} & \textbf{Ambiguity} & \textbf{Φ(average $\pm$ s.e.m.)} \\
\hline
Developmental process (32502) & 83.3\% (214/257) & 82.0\% & 7.2\% (16/222) & 0.51 $\pm$ 0.06 \\
\hline
Reproduction (3) & 96.4\% (107/111) & 82.5\% & 8.3\% (1/12) & 0.45 $\pm$ 0.03 \\
\hline
Establishment of cellular localization (51649) & 86.7\% (163/188) & 76.8\% & 46.2\% (49/106) & 0.37 $\pm$ 0.02 \\
\hline
Response to stimulus (50896) & 78.3\% (162/207) & 73.2\% & 32.1\% (18/56) & 0.48 $\pm$ 0.07 \\
\hline
Ribonucleoprotein complex (30529) & 82.3\% (79/96) & 70.7\% & 56.2\% (41/73) & 0.72 $\pm$ 0.03 \\
\hline
Organelle envelope (31967) & 87.0\% (60/69) & 79.5\% & 26.5\% (9/34) & 0.70 $\pm$ 0.05 \\
\hline
Transcription regulator activity (30528) & 39.3\% (42/107) & 64.7\% & 33.8\% (26/77) & 0.42 $\pm$ 0.03 \\
\hline
Structural molecule activity (5198) & 69.3\% (52/75) & 68.8\% & 42.3\% (22/52) & 0.91 \\
\hline
Transporter Activity (5215) & 87.3\% (55/63) & 93.6\% & 0.0\% (0/50) & 0.63 $\pm$ 0.13 \\
\hline
\end{tabular}
\end{table} | PMC2717056_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
& \textbf{A priori Genetic Group} & \textbf{Geneclass} & & & \textbf{Structure} \\
\hline
& & RFLP & SSR & RFLP & & SSR \\
\hline
Individuals & & & & Ancestry (\%) & CI & Ancestry (\%) & CI \\
\hline
AC663 & A & E 1.445 & & E 43.5 A 39 B 14.2 & 0–100 0–100 0–61 \\
\hline
CC604 & C & - & E 3.224 & & - & E 49.1 C 47.4 & 23.3–76.2 18.4–73.5 \\
\hline
CC658 & C & - & D 5.010 & & - & D 56.3 A 21.2 & 24.8–83.6 0–71.9 \\
\hline
DC186 & D & - & - & D 64 E 16 A 16 & 36.1–86.5 0–52.8 0–54.2 & D 57.9 A 33.5 & 29.6–84 0–68.3 \\
\hline
DC194 & D & - & - & D 37.5 E 29.6 A 31.6 & 0–66.1 0–85.8 0–94.2 & D 72.6 E 25.3 & 48.3–94.4 0–50.3 \\
\hline
DC345 & D & A 0.579 & E 0.526 & D 33.7 E 30 A 34.3 & 0–65.2 0–97.3 0–997 & D 51.5 E 38.7 & 26.7–74.7 12.9–65.2 \\
\hline
DC350 & D & - & E 1.553 & D 54.5 E 20.7 A 21.7 & 0–87.1 0–75.5 0–91.7 & D 42.4 E 51.6 & 19.8–65.5 14.2–76.9 \\
\hline
DC358 & D & - & - & D 49.9 E 21 A 21.5 & 12.1–77.9 0–66.6 0–68.5 & D 64.3 E 21.2 & 42.6–83.7 0–51.2 \\
\hline
\end{tabular}
\end{table} | PMC2717059_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{SSR\RFLP} & \textbf{A} & \textbf{B} & \textbf{C} & \textbf{D} & \textbf{E} \\
\hline
\textbf{A} & 0 & 0.29 & 0.50 & 0.67 & 0.30 \\
\hline
\textbf{B} & 0.33 & 0 & 0.51 & 0.67 & 0.30 \\
\hline
\textbf{C} & 0.30 & 0.24 & 0 & 0.54 & 0.41 \\
\hline
\textbf{D} & 0.50 & 0.45 & 0.32 & 0 & 0.52 \\
\hline
\textbf{E} & 0.31 & 0.20 & 0.25 & 0.34 & 0 \\
\hline
\end{tabular}
\end{table} | PMC2717059_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Variable, \% unless otherwise indicated} & \textbf{EuroSCORE > 20, n = 237} & \textbf{EuroSCORE $\leq$ 20, n = 1,184} \\
\hline
Critical preoperative state* & 24.5 & 1.0 \\
\hline
Emergency surgery & 10.1 & 0.9 \\
\hline
Concomitant thoracic aortic surgery & 16.5 & 5.7 \\
\hline
Concomitant CABG & 58.7 & 42.2 \\
\hline
Type of prosthesis \\
\hline
Bioprosthesis (tissue valve) Mechanical valve Homograft & 84.0 13.5 2.5 & 81.7 17.6 0.8 \\
\hline
Cardiopulmonary bypass time, mean min $\pm$ SD & 178.5 $\pm$ 64.4 & 148.8 $\pm$ 51.8 \\
\hline
Aortic clamp time, mean min $\pm$ SD & 122.8 $\pm$ 47.0 & 106.7 $\pm$ 37.8 \\
\hline
Prosthetic valve indexed EOA§<0.75 cm2/m2 & 4.7 & 10.4 \\
\hline
\end{tabular}
\end{table} | PMC2717063_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Outcome, \%} & \textbf{EuroSCORE > 20, n = 237} & \textbf{$\leq$ EuroSCORE 20, n = 1,184} & \textbf{P} \\
\hline
Mortality (in-hospital or within 30 days of surgery) & 11.4 & 3.2 & <0.0001 \\
\hline
In-hospital events \\
\hline
Ventilation > 24 hours & 27.9 & 9.3 & <0.0001 \\
\hline
Length of stay > 9 days & 59.1 & 28.1 & <0.0001 \\
\hline
Stroke & 5.1 & 2.3 & 0.02 \\
\hline
Atrial fibrillation (new onset) & 31.7 & 28.4 & 0.31 \\
\hline
Erythrocyte transfusion & 73.0 & 34.5 & <0.0001 \\
\hline
\textbf{P}ermanent pacemaker implantation & 10.1 & 5.4 & 0.01 \\
\hline
\end{tabular}
\end{table} | PMC2717063_table_1 | |
\begi\textbf{n}{table}
\ce\textbf{n}teri\textbf{n}g
\label{tab:tablelabel}
\begi\textbf{n}{tabular}{|l|l|l|l|l|l|l|l|l|}
\hli\textbf{n}e
\textbf{WHO} & \textbf{n} & \textbf{Age (yr)} & \textbf{MGb(\%)} & \textbf{Weight (g)} & \textbf{Masaoka I} & \textbf{Masaoka I}I & \textbf{Masaoka I}II & \textbf{Masaoka I}V \\
\hli\textbf{n}e
A & 15 & 64.0 $\pm$ 9.8 & 26.6 & 164.0 $\pm$ 293.0 & 10 & 4 & 1 & 0 \\
\hli\textbf{n}e
AB & 21 & 58.5 $\pm$ 10.6 & 14.2 & 114.0 $\pm$ 131.4 & 15 & 2 & 4 & 0 \\
\hli\textbf{n}e
B1 & 13 & 58.6 $\pm$ 6.3 & 23.0 & 103.0 $\pm$ 99.5 & 9 & 2 & 1 & 1 \\
\hli\textbf{n}e
B2 & 13 & 51.8 $\pm$ 20.3 & 53.0 & 125.0 $\pm$ 108.6 & 5 & 6 & 0 & 2 \\
\hli\textbf{n}e
B3 & 3 & 67.8 $\pm$ 23.4 & 66.6 & 166.0 $\pm$ 83.5 & 1 & 2 & 0 & 0 \\
\hli\textbf{n}e
C & 19 & 54.1 $\pm$ 13.4 & 0 & 139.0 $\pm$ 403.4 & 2 & 3 & 3 & 11 \\
\hli\textbf{n}e
Total & 84 & - & 22.6 & - & 42 & 19 & 9 & 14 \\
\hli\textbf{n}e
\e\textbf{n}d{tabular}
\e\textbf{n}d{table} | PMC2717064_table_0 | |
\begi\textbf{n}{table}
\ce\textbf{n}teri\textbf{n}g
\label{tab:tablelabel}
\begi\textbf{n}{tabular}{|l|l|l|l|l|l|l|}
\hli\textbf{n}e
\textbf{Masaoka} & \textbf{n} & \textbf{R0-status} & \textbf{N1} & \textbf{M1} & Recurre\textbf{n}ce & \textbf{5-year survival (\%)} \\
\hli\textbf{n}e
I & 42 & 42 (100\%) & 0 (0\%) & 0 (0\%) & 0 (0\%) & 97.6 \\
\hli\textbf{n}e
II & 19 & 18 (94.7\%) & 0 (0\%) & 0 (0\%) & 1 (5.3\%) & 94.7 \\
\hli\textbf{n}e
III & 9 & 6 (66.7\%) & 0 (0\%) & 0 (0\%) & 0 (0\%) & 66.7 \\
\hli\textbf{n}e
IV & 14 & 5 (35.7\%) & 6 (42.8\%) & 8 (57.1) & 1 (7\%) & 64.3 \\
\hli\textbf{n}e
\e\textbf{n}d{tabular}
\e\textbf{n}d{table} | PMC2717064_table_1 | |
\begi\textbf{n}{table}
\ce\textbf{n}teri\textbf{n}g
\label{tab:tablelabel}
\begi\textbf{n}{tabular}{|l|l|l|l|l|l|}
\hli\textbf{n}e
\textbf{Characteristics} & \textbf{n} & \textbf{Pseudocapsula complete} & Pseudocapsula i\textbf{n}complete & Pseudocapsula \textbf{n}o capsula & \textbf{p-valueb} \\
\hli\textbf{n}e
Masaoka I & 42 & 38 & 4 & 0 & 0.001 \\
\hli\textbf{n}e
II & 19 & 1 & 16 & 2 \\
\hli\textbf{n}e
III & 9 & 1 & 3 & 5 \\
\hli\textbf{n}e
IV & 14 & 0 & 3 & 11 \\
\hli\textbf{n}e
N-status N0 & 79 & 40 & 24 & 15 & 0.042 \\
\hli\textbf{n}e
N1 & 5 & 0 & 2 & 3 \\
\hli\textbf{n}e
M-status M0 & 76 & 40 & 25 & 11 & 0.001 \\
\hli\textbf{n}e
M1 & 8 & & 1 & 7 \\
\hli\textbf{n}e
Vessel i\textbf{n}filtratio\textbf{n} & 13 & 0 & 3 & 9 & 0.001 \\
\hli\textbf{n}e
Pericard i\textbf{n}filtratio\textbf{n} & 14 & 1 & 1 & 12 & 0.001 \\
\hli\textbf{n}e
Recurre\textbf{n}ce & 2 & 0 & 1 & 1 & 0.047 \\
\hli\textbf{n}e
Age (yr)c & 84 & 40 & 26 & 18 & 0.44 \\
\hli\textbf{n}e
Sex Male & 45 & 14 & 17 & 14 & 0.004 \\
\hli\textbf{n}e
Female & 39 & 26 & 9 & 4 \\
\hli\textbf{n}e
MGd & 19 & 10 & 6 & 3 & 0.86 \\
\hli\textbf{n}e
\e\textbf{n}d{tabular}
\e\textbf{n}d{table} | PMC2717064_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Risk factor} & \textbf{Univariate analysis} & \multicolumn{3}{c|}{\textbf{Multivariate analysisc}} \\
\hline
& \textbf{\textbf{p value}b} & \textbf{Relative risk} & \textbf{95\% Confidence interval} & \textbf{p value} \\
\hline
R-status & 0.0001 & 3.9 & 2.0 – 7.6 & 0.001 \\
\hline
Masaoka stagingd & 0.0001 & 2.0 & 1.0 – 4.1 & 0.020 \\
\hline
Presence of a pseudocapsula & 0.0002 & - & - & 0.179 \\
\hline
WHOd classificatione & 0.0001 & - & - & 0.181 \\
\hline
Sex & 0.562 & - & - & 0.849 \\
\hline
Age & 0.360 & - & - & 0.206 \\
\hline
\end{tabular}
\end{table} | PMC2717064_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Examination subject} & \textbf{Date} & \textbf{Format} & \textbf{Reliability (KR20)} \\
\hline
\multirow{2}{*}{Generic clinical knowledge} & March & EMQ & 0.758 \\
\hline
August & EMQ & 0.730 \\
\hline
Care of the Elderly and & March & SBA & 0.760 \\
\hline
General Medical Specialties & August & SBA & 0.757 \\
\hline
\multirow{2}{*}{General Medicine, Medicine in the Community and Surgery} & March & SBA & 0.760 \\
\hline
August & SBA & 0.705 \\
\hline
\end{tabular}
\end{table} | PMC2717066_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{Intervention group n = (\%)} & \textbf{Control group n = (\%)} & \textbf{Total n = (\%)} & \textbf{Group differences} & \textbf{p value} \\
\hline
& \multicolumn{2}{c|}{\textbf{Total n = (\%)}Tutor} \\
\hline
Total & 6 & 6 & 12 & n/a & n/a \\
\hline
male & 1 (16.7) & 2 (33.3) & 3 (25.0) & n/a & n/a \\
\hline
white & 6 (100.0) & 5 (83.3) & 11 (91.7) & n/a & n/a \\
\hline
& \multicolumn{2}{c|}{Student factors} \\
\hline
Total & 177/348 (50.9) & 171/348 (49.1) & 348 (100.0) \\
\hline
Mean age & 22 yrs 4 months & 22 yrs 4 months & 22 yrs 4 months & t(346) = 0.8 & 0.94 \\
\hline
white* & 80/175 (45.7) & 87/166 (52.5) & 167/341 (49.0) & χ2 = 1.9; df = 3 & 0.60 \\
\hline
Asian Indian, Pakistani, Bangladeshi & 47/175 (26.9) & 37/166 (22.3) & 84/341 (34.0) & χ2 = 1.9; df = 3 & 0.60 \\
\hline
Chinese & 16/175 (9.1) & 12/166 (7.2) & 28/341 (8.2) & χ2 = 1.9; df = 3 & 0.60 \\
\hline
All Other & 32/175 (18.3) & 30/166 (18.1) & 62/341 (18.2) & χ2 = 1.9; df = 3 & 0.60 \\
\hline
Male** & 69/176 (39.2) & 59/171 (34.5) & 128/347 (36.9) & χ2 = 0.8; df = 1 & 0.36 \\
\hline
Graduate entry*** & 23/176 (13.1) & 20/166 (12.1) & 43/342 (12.6) & χ2 = 0.1; df = 1 & 0.75 \\
\hline
With iBSC*** & 107/176 (60.8) & 101/166 (60.8) & 208/342 (60.8) & χ2 = 0.2; df = 1 & 0.89 \\
\hline
Oxford or Cambridge transfer & 21/177 (11.9) & 30/171 (17.5) & 51/348 (14.7) & χ2 = 2.2; df = 1 & 0.13 \\
\hline
Mean pre-intervention written z score & 0.05 (SD = 1.0) & -0.05 (SD = 1.0) & 0.00 (SD = 1.0) & t(343) = -0.9 & 0.36 \\
\hline
Mean Neuroticism score & 8.1 (SD = 2.3) & 7.8 (SD = 2.3) & 8.0 (SD = 2.3) & t(270) = -0.8 & 0.45 \\
\hline
Mean Conscientiousness score & 11.3 (SD = 2.6) & 11.3 (SD = 2.0) & 11.3 (SD = 2.3) & t(272) = 0.2 & 0.86 \\
\hline
Mean Openness score & 11.1 (SD = 2.2) & 10.9 (SD = 2.4) & 11.0 (SD = 2.3) & t(272) = -0.9 & 0.39 \\
\hline
Mean Agreeableness score & 13.3 (SD = 1.6) & 13.0 (SD = 1.6) & 13.2 (SD = 1.6) & t(268) = -1.8 & 0.07 \\
\hline
Mean Extraversion score & 11.6 (SD = 2.1) & 11.6 (SD = 1.8) & 11.6 (SD = 1.9) & t(271) = -0.13 & 0.90 \\
\hline
Mean Surface study score & 14.9 (SD = 3.9) & 14.7 (SD = 3.4) & 14.8 (SD = 3.6) & t(265) = -0.5 & 0.61 \\
\hline
Mean Strategic study score & 18.5 (SD = 5.4) & 17.7 (SD = 4.7) & 18.1 (SD = 5.1) & t(266) = -0.8 & 0.45 \\
\hline
Mean Deep study score & 19.4 (SD = 4.1) & 19.3 (SD = 3.9) & 19.3 (SD = 4.0) & t(267) = -0.3 & 0.79 \\
\hline
Mean GHQ (stress) score & 11.4 (SD = 5.3) & 10.2 (SD = 4.4) & 10.8 (SD = 4.9) & t(262) = -1.9 & 0.06 \\
\hline
\end{tabular}
\end{table} | PMC2717066_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Ethnic group} & \textbf{Condition} & \textbf{Mean written z-score (SD)} & \textbf{Mean OSCE z-score (SD)} & \textbf{N} \\
\hline
\multirow{2}{*}{W} & Intervention & 0.063 (0.90) & 0.271 (0.96) & 79 \\
\hline
Control & 0.244 (1.00) & -0.002 (0.96) & 84 \\
\hline
\multirow{2}{*}{EM} & Intervention & -0.098 (1.09) & 0.001 (1.00) & 95 \\
\hline
Control & -0.175 (0.96) & -0.286 (0.97) & 77 \\
\hline
\end{tabular}
\end{table} | PMC2717066_table_2 | |
\begin{\textbf{t}able}
\cen\textbf{t}ering
\label{\textbf{t}ab:\textbf{t}ablelabel}
\begin{\textbf{t}abular}{|l|l|l|l|l|l|l|l|}
\hline
\\textbf{t}ex\textbf{t}bf{Dimensions} & \\textbf{t}ex\textbf{t}bf{Word ca\textbf{t}egories} & \\textbf{t}ex\textbf{t}bf{Type of word} & \\textbf{t}ex\textbf{t}bf{Group wi\textbf{t}h highes\textbf{t} frequency} & \textbf{t} & Mean use by all s\textbf{t}uden\textbf{t}s & Mean Difference be\textbf{t}ween groups & \textbf{p value} \\
\hline
\mul\textbf{t}irow{2}{*}{S\textbf{t}andard linguis\textbf{t}ic dimensions} & \% of dic\textbf{t}ionary words & & EM & -2.0 & 75.5 & -1.2 & 0.04 \\
\hline
To\textbf{t}al pronouns & Pronoun & EM & -2.8 & 10.9 & -0.9 & 0.01 \\
\hline
\mul\textbf{t}irow{4}{*}{Psychologi-cal processes} & Affec\textbf{t}ive or emo\textbf{t}ional processes & Op\textbf{t}imism and energy (cer\textbf{t}ain\textbf{t}y, pride, win) & W & 2.0 & 0.9 & 0.2 & 0.05 \\
\hline
Cogni\textbf{t}ive processes & Cogni\textbf{t}ive processes & EM & -2.2 & 0.1 & -0.5 & 0.03 \\
\hline
Sensory and percep\textbf{t}ual processes & Hear (heard, lis\textbf{t}en, sound) & EM & -3.5 & 0.9 & -0.3 & <0.001 \\
\hline
Social Processes & Communica\textbf{t}ion (\textbf{t}alk, share converse) & EM & -2.4 & 2.2 & -0.4 & 0.02 \\
\hline
Rela\textbf{t}ivi\textbf{t}y & Mo\textbf{t}ion & Mo\textbf{t}ion (walk, move, go) & EM & -2.5 & 0.9 & -0.2 & 0.01 \\
\hline
\mul\textbf{t}irow{2}{*}{Personal Concerns} & Occupa\textbf{t}ion & Job or work (employ, boss, career) & W & 2.2 & 1.1 & 0.2 & 0.03 \\
\hline
Me\textbf{t}aphysical issues & Religion (God, church, rabbi) & EM & -2.1 & 0.2 & -0.2 & 0.04 \\
\hline
\end{\textbf{t}abular}
\end{\textbf{t}able} | PMC2717066_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Characteristics} & \textbf{Study aggregate} \\
\hline
Age (year), Median (IQR*) & 35 (33–37) \\
\hline
Gender (W:M) & 43\%/57\% \\
\hline
Married & 65\% \\
\hline
Time from medical school to residency training (years), Median (IQR*) & 5 (4–7) \\
\hline
Visa status (J1/H1/Employment authorization) & 88\% \\
\hline
Asian origin & 59\% \\
\hline
USMLE Step 1, Median (IQR*) & 85 (80–88) \\
\hline
USMLE Step 2 Clinical skills, Median (IQR*) & 82 (79–87) \\
\hline
Pre-GME Clinical experience, n (\%) & 43/51 (84) \\
\hline
Pre-GME Research Experience, n (\%) & 34/51 (66.7) \\
\hline
US Externship, n (\%) & 14/51 (27.5) \\
\hline
Pre-GME Awards, n (\%) & 26/51(50.1) \\
\hline
ABIM examination pass, n (\%) & 49/51(96) \\
\hline
Fellowship aspirants, n (\%) & 12/51 (23.5) \\
\hline
Fellowship within 3 years after graduation, n (\%) & 8/51 (16) \\
\hline
\end{tabular}
\end{table} | PMC2717068_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Characteristics} & \textbf{Above PG level median (n = 18)} & \textbf{Below PG level median (n = 33)} & \textbf{*P value} \\
\hline
Age, median (range) in years & 33 (31–40) & 36 (31–47) & < 0.05 \\
\hline
Male:Female (ratio) & 9:9 & 20:13 & NS \\
\hline
Marital Status (unmarried: married) & 5:13 & 13:20 & NS \\
\hline
Asian/Others & 3/5 & 16/17 & NS \\
\hline
#USMLE step I median (range) & 86 (76–97) & 83 (75–96) & NS \\
\hline
USMLE step II Clinical skills median (range) & 86 (77–93) & 80 (75–92) & < 0.05 \\
\hline
Time from medical school to residency, median (range) in years & 4 (1 – 14) & 5 (1–17) & NS \\
\hline
Temporary Visa status (n) & 16 & 29 & NS \\
\hline
Pre-GME Clinical Experience (n) & 15 & 28 & NS \\
\hline
Pre-GME Research Experience (n) & 12 & 22 & NS \\
\hline
US Externship & 7 & 7 & NS \\
\hline
Pre-GME Awards & 9 & 17 & NS \\
\hline
\end{tabular}
\end{table} | PMC2717068_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Characteristics} & \textbf{Above US Median (n = 13)} & \textbf{Below US Median (n = 38)} & \textbf{*P value} \\
\hline
Age, median (range) in years & 35 (32–42) & 35.5 (31–47) & NS \\
\hline
**Male/Female (ratio) & 11:2 & 18: 20 & < 0.05 \\
\hline
Marital Status (unmarried/married) & 8: 5 & 25: 13 & NS \\
\hline
Asian/Others & 9/4 & 21/17 & NS \\
\hline
#USMLE step I median (range) & 86 (76–97) & 83 (75–96) & < 0.05 \\
\hline
USMLE step II Clinical Skills median (range) & 86 (77–93) & 80 (75–92) & < 0.05 \\
\hline
Time from medical school to residency, median (range) in years & 4 (1 – 14) & 5 (1–17) & NS \\
\hline
Temporary Visa status (n) & 11 & 34 & NS \\
\hline
Pre-GME Clinical Experience (n) & 15 & 28 & NS \\
\hline
Pre-GME Research Experience (n) & 12 & 22 & NS \\
\hline
US Externship & 7 & 7 & NS \\
\hline
Pre-GME Awards & 9 & 17 & NS \\
\hline
\end{tabular}
\end{table} | PMC2717068_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{#Characteristics} & \textbf{Above US Median} & \textbf{Below US Median} & \textbf{P value} \\
\hline
\multicolumn{2}{c|}{(Above median} \\
\hline
Male/Female (ratio) (unadjusted analysis) & 22:10 & 7: 12 & < 0.05 \\
\hline
#USMLE step I median (range) & 85 (77–97) & 82 (75–96) & NS \\
\hline
USMLE step II Clinical skills median (range) & 85.5 (75–93) & 81 (76–87) & NS \\
\hline
\multicolumn{2}{c|}{(Above median} \\
\hline
Male/Female (ratio) (unadjusted analysis) & 11: 3 & 18: 19 & NS \\
\hline
#USMLE step I median (range) & 86.5 (76–97) & 82.5 (75–90) & < 0.05 \\
\hline
USMLE step II Clinical skills median (range) & 85.5 (75–93) & 81 (76–87) & < 0.05 \\
\hline
\end{tabular}
\end{table} | PMC2717068_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Characteristics (units)} & \textbf{Fellowship pursuing residents (n = 8)} & \textbf{Others (n = 43)} & \textbf{P value} \\
\hline
Age, median (range) in years & 33 (31 – 39) & 35 (31–47) & NS \\
\hline
Male/Female (ratio) & 4:4 & 25: 18 & NS \\
\hline
Marital status (unmarried/married) & 6: 2 & 27:16 & NS \\
\hline
Asian/Others & 4/4 & 26/17 & NS \\
\hline
#USMLE step I median (range) & 85 (76–97) & 85 (75–96) & NS \\
\hline
USMLE step II Clinical skills median (range) & 82.5 (80–92) & 82 (75–93) & NS \\
\hline
Time from medical school to residency, median (range) in years & 5 (3 – 14) & 5 (1–17) & NS \\
\hline
Visa status & 7 & 38 & NS \\
\hline
Pre-GME Clinical Experience (n) & 7 & 36 & NS \\
\hline
Pre-GME Research Experience (n) & 5 & 29 & NS \\
\hline
US Externship (n) & 1 & 13 & NS \\
\hline
Pre-GME Awards (n) & 5 & 21 & NS \\
\hline
Fellowship aspirants (n) & 7 & 5 & < 0.05 \\
\hline
GME Research (n) & 7 & 12 & < 0.05 \\
\hline
\end{tabular}
\end{table} | PMC2717068_table_4 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Question} & \multicolumn{7}{c|}{\textbf{Likert Scale}} \\
\hline
\textbf{How valuable has the student housing conditions survey, and discussion of findings, been for you?} & \textbf{Extremely valuable} & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & \textbf{Not at all valuable} \\
\hline
& No. & \textbf{2}9 & 60 & \textbf{3}\textbf{2} & \textbf{1}\textbf{2} & \textbf{3} \\
\hline
& \% & \textbf{2}\textbf{1}\% & \textbf{4}\textbf{4}\% & \textbf{2}\textbf{4}\% & 9\% & \textbf{2}\% \\
\hline
\multirow{\textbf{3}}{*}{Did this survey and seminar discussion improve your understanding of research methods?} & Yes, greatly & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & No, not at all \\
\hline
No. & \textbf{1}8 & \textbf{5}\textbf{2} & \textbf{4}7 & \textbf{1}\textbf{3} & 6 \\
\hline
\% & \textbf{1}\textbf{3}\% & \textbf{3}8\% & \textbf{3}\textbf{5}\% & \textbf{1}0\% & \textbf{4}\% \\
\hline
\multirow{\textbf{3}}{*}{Did this survey and seminar discussion improve your understanding of epidemiology?} & Yes, greatly & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & No, not at all \\
\hline
No. & \textbf{1}6 & \textbf{4}\textbf{1} & \textbf{5}\textbf{2} & \textbf{2}0 & 7 \\
\hline
\% & \textbf{1}\textbf{2}\% & \textbf{3}0\% & \textbf{3}8\% & \textbf{1}\textbf{5}\% & \textbf{5}\% \\
\hline
\multirow{\textbf{3}}{*}{Did this survey and seminar discussion improve your understanding of the environmental determinants of health?} & Yes, greatly & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & No, not at all \\
\hline
No. & \textbf{2}8 & 69 & \textbf{3}0 & 7 & \textbf{2} \\
\hline
\% & \textbf{2}\textbf{1}\% & \textbf{5}\textbf{1}\% & \textbf{2}\textbf{2}\% & \textbf{5}\% & \textbf{1}\% \\
\hline
\multirow{\textbf{3}}{*}{Did this survey and seminar discussion improve your interest in public health?} & Yes, greatly & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & No, not at all \\
\hline
No. & \textbf{2}\textbf{3} & \textbf{5}8 & \textbf{3}\textbf{4} & \textbf{1}\textbf{2} & 9 \\
\hline
\% & \textbf{1}7\% & \textbf{4}\textbf{3}\% & \textbf{2}\textbf{5}\% & 9\% & 7\% \\
\hline
\multirow{\textbf{3}}{*}{Did this survey and seminar discussion improve your interest in health research?} & Yes, greatly & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & No, not at all \\
\hline
No. & \textbf{1}6 & \textbf{4}8 & \textbf{4}6 & \textbf{1}\textbf{5} & \textbf{1}\textbf{1} \\
\hline
\% & \textbf{1}\textbf{2}\% & \textbf{3}\textbf{5}\% & \textbf{3}\textbf{4}\% & \textbf{1}\textbf{1}\% & 8\% \\
\hline
\multirow{\textbf{3}}{*}{Did this survey stimulate you to discuss housing and health issues with friends outside of class?} & Yes, often & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & No, never \\
\hline
No. & \textbf{3}0 & \textbf{4}\textbf{5} & \textbf{4}\textbf{3} & \textbf{1}\textbf{3} & \textbf{5} \\
\hline
\% & \textbf{2}\textbf{2}\% & \textbf{3}\textbf{3}\% & \textbf{3}\textbf{2}\% & \textbf{1}0\% & \textbf{4}\% \\
\hline
\multirow{\textbf{3}}{*}{How much did this survey and seminar discussion challenge you to think?} & A great deal & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & Very Little \\
\hline
No. & \textbf{2}\textbf{1} & 6\textbf{3} & \textbf{3}\textbf{5} & \textbf{1}\textbf{1} & \textbf{5} \\
\hline
\% & \textbf{1}\textbf{5}\% & \textbf{4}6\% & \textbf{2}6\% & 8\% & \textbf{4}\% \\
\hline
\multirow{\textbf{3}}{*}{Has this survey and seminar discussion made you more aware and concerned about societal problems?} & Yes, greatly & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & No, not at all \\
\hline
No. & \textbf{3}8 & \textbf{5}7 & \textbf{3}\textbf{2} & \textbf{4} & \textbf{4} \\
\hline
\% & \textbf{2}8\% & \textbf{4}\textbf{2}\% & \textbf{2}\textbf{4}\% & \textbf{3}\% & \textbf{3}\% \\
\hline
\multirow{\textbf{3}}{*}{Would you support use of this survey and seminar discussion for future \textbf{3}rd year classes?} & Yes, greatly & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & No, not at all \\
\hline
No. & \textbf{5}6 & \textbf{4}9 & \textbf{2}\textbf{3} & 6 & \textbf{2} \\
\hline
\% & \textbf{4}\textbf{1}\% & \textbf{3}6\% & \textbf{1}7\% & \textbf{4}\% & \textbf{1}\% \\
\hline
\end{tabular}
\end{table} | PMC2717069_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Groups}} \\
\hline
& \textbf{Hypoglycemic (n = 436)} & \textbf{Controls (n = 434)} & \textbf{P-value} \\
\hline
Cervical ripening & 36 (8\%) & 38 (9\%) & 0.792 \\
\hline
Induction of labor & 129 (30\%) & 87 (20\%) & <0.001 \\
\hline
Delivery mode \\
\hline
Spontaneous vaginal & 314 (72\%) & 295 (68\%) \\
\hline
Assisted vaginal & 15 (3\%) & 14 (3\%) \\
\hline
Cesarean section & 107 (25\%) & 125 (29\%) & 0.364 \\
\hline
Reason for cesarean section(1) \\
\hline
Fetal distress & 26 (24\%) & 23 (18\%) \\
\hline
Failure to progress & 24 (22\%) & 36 (29\%) \\
\hline
Repeat cesarean section & 35 (32\%) & 46 (37\%) \\
\hline
Breech/transverse lie & 11 (10\%) & 9 (7\%) \\
\hline
Other & 11 (10\%) & 11 (9\%) & 0.572 \\
\hline
Reason for assisted vaginal delivery(1) \\
\hline
Fetal distress & 12 (80\%) & 10 (71\%) \\
\hline
Other & 3 (20\%) & 4 (29\%) & 0.682 \\
\hline
Fetal distress in labor & 38 (9\%) & 33 (8\%) & 0.621 \\
\hline
Cesarean delivery for fetal distress & 26 (6\%) & 23 (5\%) & 0.769 \\
\hline
Gestational age at delivery (med, min-max) & 39 (23–41.5) & 39 (28.6–41.6) & 0.689 \\
\hline
Gestational age distribution \\
\hline
<37 & 67 (15\%) & 43 (10\%) \\
\hline
37–40 & 242 (56\%) & 273 (63\%) \\
\hline
>40 & 127 (29\%) & 118 (27\%) & 0.024 \\
\hline
Gestational age at delivery <37 & 67 (15\%) & 43 (10\%) & 0.015 \\
\hline
\end{tabular}
\end{table} | PMC2717071_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Group}} \\
\hline
& \textbf{Hypoglycemic (n = 436)} & \textbf{Controls (n = 434)} & \textbf{P-value} \\
\hline
Birth weight (gm) (med, Q1-Q3) & 3240 (2928–3550) & 3313 (2980–3690) & 0.008 \\
\hline
Birth weight distribution \\
\hline
<2500 & 43 (10\%) & 22 (5\%) \\
\hline
2500–4000 & 370 (85\%) & 370 (85\%) \\
\hline
>4000 & 23 (5\%) & 42 (10\%) & 0.002 \\
\hline
IUGR & 36 (12\%) & 29 (9\%) & 0.277 \\
\hline
Umbilical artery pH<7.1 & 14 (3\%) & 7 (2\%) & 0.130 \\
\hline
5 minutes Apgar score <7 & 4 (1\%) & 1 (.2\%) & 0.374 \\
\hline
Admission to NICU & 36 (8\%) & 25 (6\%) & 0.149 \\
\hline
Admission reasons(2) \\
\hline
Prematurity & 6 (17\%) & 4 (16\%) \\
\hline
RDS/TTN & 26 (72\%) & 12 (48\%) \\
\hline
Other(2) & 4 (11\%) & 9 (36\%) & 0.054 \\
\hline
\end{tabular}
\end{table} | PMC2717071_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Outcome} & \textbf{OR} & \textbf{\textbf{95\% CI}} & \textbf{RR} & \textbf{\textbf{95\% CI}} & \textbf{p-value} \\
\hline
Preeclampsia & 3.13 & 1.51–6.51 & 2.98 & 1.49–5.78 & 0.002 \\
\hline
Induction of labor & 1.75 & 0.83–1.66 & 1.52 & 0.86–1.47 & 0.361 \\
\hline
Preterm delivery & 1.61 & 0.92–2.82 & 1.52 & 0.93–2.39 & 0.093 \\
\hline
IUGR & 1.24 & 0.73–2.10 & 1.21 & 0.75–1.91 & 0.425 \\
\hline
Macrosomia & 0.49 & 0.28–0.85 & 0.51 & 0.30–0.86 & 0.011 \\
\hline
Umbilical artery pH<7.1 & 2.00 & 0.76–5.26 & 1.97 & 0.77–4.93 & 0.159 \\
\hline
5 min Apgar score <7 & 1.97 & 0.20–19.91 & 1.97 & 0.20–19.19 & 0.564 \\
\hline
NICU admission & 1.27 & 0.62–2.05 & 1.12 & 0.63–1.94 & 0.965 \\
\hline
\end{tabular}
\end{table} | PMC2717071_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Code} & \textbf{Clinician Comments} \\
\hline
Assessment of Severity & "By how much the patient describes the itch. Like, if they say, it wakes me up at night, or it keeps me up at night, or it's relentless, or it drives me crazy, I know the itch is severe. Plus, you know, I might ask the patient to grade it on a scale of one to ten, how bad is your itch, with ten being the worst, one is being pretty mild or not present. (...) Oh, just the one to ten scale, that's the only systematic way I can grade itch numerically." "Well, I don't have a scale typically in the clinic. There is no numeric scale that I use, but I go by whether it keeps them up at night, or not. That's typically the threshold. The severity of itching really keeps a patient aware at night, and that's about it. I know that's very subjective, but I don't use anything more quantifiable than itch." \\
\hline
Itch & "In psoriasis it's less than it is for atopic dermatitis. It doesn't usually keep them up at night, but it is, in some people, a symptom that is annoying, rather than disabling." "If they're able to sleep at night, or it disables them during the daytime, if they've got to stop what they're doing to scratch. I also – well, I look at their skin to see if there are scratch marks, and if there's other accompanying signs of what we call excoriations, where they're digging at their skin, scratching and digging at their skin." "Itch is a very bothersome symptom for psoriasis and other skin conditions such as eczema. And itch can be more problematic than pain. Itch is constant. Itch is something patients are much more aware of, and they're always scratching themselves to the point where they start to bleed, and their skin gets infected. And it's usually worse at nighttime, because patients are more aware about their body, as opposed to daytime, where people are more – you know, they're more busy at work and things. That's when then get home, then they start to itch more. But I would say itch by far is the number one factor that drives patients crazy." \\
\hline
Relevance of itch & "I think it's highly relevant, because it's probably the most day in, day out thing that a lot of people face in that the itching is – comes to the top of forefront of symptomology, whether it's itching in your scalp, or itching on the patches of psoriasis. And it's again probably one of the single most bothersome things, other than the fact that it's there." \\
\hline
Location & "Scalp – wherever the plaques are, but scalp drives them crazy. Anywhere on the body." "Is the itch from lesions? Usually, yes." "Commonly hands, knees, ankles." "Their scalp and their lower legs. It can be where there's no lesions in the scalp, but in the lower legs there usually some evidence of dry, scaling skin with some scratch marks." \\
\hline
Treatment/management challenges & "Like if the treatment works, that's great, but if it doesn't work, then we've got to keep adding things to help control the itch, whether it be a pill for itch that they take at nighttime, like an antihistamine, or using various creams to keep applying to control the itch... I would probably say maybe 60\% of the time the itch can be controlled with one treatment, whether it be the shots or light therapy. And then 40\% of the time it's not adequate, it's got to add in something else, like a topical cream, to control the itch." "Particular challenges (related to the treatment or management of the itch)? Again, I think it's related to treating the underlying psoriasis itself." "Yes, there's no specific oral anti-itch medication. And some of the topical anti-itch medications are not always effective for long periods of time over large areas of the skin. Effective or feasible. If they have total body involvement, it's hard to – lotions, anti-itch lotions all over their body." \\
\hline
\end{tabular}
\end{table} | PMC2717072_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Focus Groups}} \\
\hline
& \textbf{Patients with Mild Psoriasis (N = 8)} & \textbf{Patients with Severe Psoriasis (N = 31)} \\
\hline
Female sex, n (\%) & 5 (63) & 17 (55) \\
\hline
Age, mean years (range) & 36 (20 – 74) & 45 (22 – 66) \\
\hline
Race/Ethnicity, n (\%) \\
\hline
White & 5 (63) & 24 (77) \\
\hline
Black/African American & 0 & 4 (13) \\
\hline
Hispanic & 1 (13) & 1 (3) \\
\hline
Mexican-American & 1 (13) & 0 \\
\hline
Arabic & 1 (13) & 0 \\
\hline
Spanish & 0 & 1 (3) \\
\hline
Disease Diagnosis, n (\%) \\
\hline
Psoriasis & 8 (100) & 29 (94)b \\
\hline
Co-existing Psoriatic arthritis & 0 & 1 (3) \\
\hline
Heath Status, n (\%) \\
\hline
Excellent & 1 (13) & 3 (10) \\
\hline
Very good & 4 (50) & 9 (29) \\
\hline
Good & 3 (38) & 13 (42) \\
\hline
Fair & 0 & 4 (13) \\
\hline
Poor & 0 & 2 (7) \\
\hline
\end{tabular}
\end{table} | PMC2717072_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Code/domain} & \textbf{Patient Comment (Severity of Psoriasis)} \\
\hline
Symptoms/itch & "You itch a lot. Scratch a lot, I mean." (Severe) "Scratch to relieve." (Severe) "It will spread over my whole body, the itching. I'll get scabs on my knees, on my elbows that (...) like yours (...) are very, very bad, and the more you scratch it, the worse it gets. (...) it just spreads." (Severe) "The worst is, for me, is just the itching. The itch and the dry." (Severe) "My itching, it gets inflamed. (...) It spreads – (...) And the more you scratch – you're scratching – (...) Mainly the itching." (Mild) "Because I'm scratching everywhere, people not knowing the reason why I'm scratching." (Mild) \\
\hline
Change of psoriasis symptoms due to anxiety/worsen & "So that's the worst, that's when I start to get really anxious. And it, like I said, it can change over the course of a day. When I know I got to start getting ready for work, that puts me in a whole other frame of mind and I will notice that I'm itching a little bit more and or maybe my hands are not as calm as they are on my days off." (Severe) \\
\hline
Change of psoriasis symptoms due to stress/worsen & "Mine only itches when I'm under stress." (Severe) "...I'll be thinking about it way too much, and then I'll start getting – affecting my skin, because the stress will make it outbreak, and then the outbreak, I'll want to itch, and just scratch..." (Severe) \\
\hline
Change of psoriasis symptoms over day/varies & "Yeah, for me it changes a lot too... Towards the end of the night is when it's usually more itchy for me." (Severe) \\
\hline
Change of psoriasis symptoms over week/varies & "...and then Sunday will hit, and then that's it. Then I'll start itching again, so it's like – and Mondays are so busy at work. And like towards Wednesday – that's – I don't know. It's like Monday and Wednesday. Those two days that – I don't know why those – hate those days. (Severe) "The itching to me varies. (...) Just sometimes I don't even think about it and other times it just, boom, it's just itching." (Severe) \\
\hline
Impact on daily activities/difficulty concentrating & "You lose concentration, because you want to scratch and (...) really want to itch this, but you don't want to itch it in front of somebody, and so you trail off to what you were originally helping somebody with, if you're working." (Mild) "Lack of concentration, or itchy – if you're really over-itchy, sometimes it's hard to concentrate on something else other than that whole-body itch." (Severe) \\
\hline
Impact on daily activities/choice of clothing & "For some reason whenever I have anything that's 100\% cotton I tend to itch more. It gets irritated more, so everything is based on clothing or cotton. I try to buy a certain type of clothes. So and that's what I got to wear all the time." (Severe) \\
\hline
Impact on emotions/embarrassed & "I'm in front of people all day long, and it's incredibly embarrassing to start bleeding in front of someone, or scratching uncontrollably when you're not even thinking about it." (Severe) "Mine is just more of embarrassment. When you're scratching and people see things coming off of you or on your clothing..." (Mild) \\
\hline
Impact on sleep/difficulty falling asleep & "Before you go to sleep yeah. (...) Because your itches." (Mild) "It's itching instead of falling asleep." (Severe) "It's falling asleep, when it's itching, and you – and then the minute you start scratching, it only makes it worse. But it's hard...You tell yourself not to scratch, but you think you're going to stop it, you know? And then you scratch it, it only makes it worse, and you want to scratch more, and scratch more. It's bad." (Severe) \\
\hline
Impact on sleep/difficulty staying asleep & "Well, no. I'm going to wake up, I'm itchy. I'm going to put some cortisone on, I'm going grease myself down – then I'm going to try and go back to bed." (Severe) "Just, I want to rip my skin off, because it wakes me up. It's like it's never-ending." (Severe) \\
\hline
Miss days of school or work because of psoriasis/itch & "Yeah, you go every week and you get shots to stop you from itching." (Severe) "And I had it on my feet really bad, and I actually missed several days of work... Well, it's the itching." (Severe) "I can't just go out there (...) taking the train to work, being around a bunch of people, and coming back home – the whole time I just want to scratch and itch..." (Severe) \\
\hline
\end{tabular}
\end{table} | PMC2717072_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{Patients with Mild Disease (N = 8)} & \textbf{Patients with Severe Disease (N = 31)} & \textbf{All Patients (N = 39)} \\
\hline
Patients rating itch as the most important symptoma \\
\hline
No. of patients, n & 8 & 23 & 31 \\
\hline
Mean rating & 9.1 & 8.5 & 8.7 \\
\hline
Patients rating a 10, \% & 88\% & 70\% & 74\% \\
\hline
Patients rating itch as the most severe symptomb \\
\hline
No. of patients, n & 8 & 23 & 31 \\
\hline
Mean rating & 5.8 & 8.1 & 7.5 \\
\hline
Patients rating a 10, \% & 0\% & 48\% & 35\% \\
\hline
Patients rating itch as the most troublesome symptomc \\
\hline
No. of patients, n & 8 & 16 & 24 \\
\hline
Mean rating & 9.0 & 8.0 & 8.3 \\
\hline
Patients rating a 10, \% & 63\% & 50\% & 54\% \\
\hline
\end{tabular}
\end{table} | PMC2717072_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{Total Responses} & \textbf{FG 1 vs FG 2} & \textbf{FG 1–2 vs FG 3} & \textbf{FG 1–3 vs FG 4} & \textbf{FG 1–4 vs FG 5} \\
\hline
Symptoms \\
\hline
Itch & 19 & 4 vs 4 & 8 vs 3 & 11 vs 5 & 16 vs 3 \\
\hline
Bleeding & 13 & 3 vs 5 & 8 vs 1 & 9 vs 3 & 12 vs 1 \\
\hline
Cracking & 12 & 0 vs 5 & 5 vs 4 & 9 vs 3 & 12 vs 0 \\
\hline
Scaling & 12 & 2 vs 4 & 6 vs 4 & 10 vs 1 & 11 vs 1 \\
\hline
Dry skin & 6 & 1 vs 1 & 2 vs 1 & 3 vs 3 & 6 vs 0 \\
\hline
Impact on daily activities \\
\hline
Choice of clothing & 17 & 2 vs 6 & 8 vs 2 & 10 vs 4 & 14 vs 3 \\
\hline
Effects on work & 9 & 3 vs 2 & 5 vs 0 & 5 vs 2 & 7 vs 2 \\
\hline
More laundry/replacing clothes and linens & 2 & 2 vs 0 & 2 vs 0 & 2 vs 0 & 2 vs 0 \\
\hline
Household duties & 1 & 0 vs 1 & 1 vs 0 & 1 vs 0 & 1 vs 0 \\
\hline
Impact on social life \\
\hline
Interaction with others & 15 & 3 vs 5 & 8 vs 3 & 11 vs 3 & 14 vs 1 \\
\hline
Attending social events & 5 & 0 vs 2 & 2 vs 2 & 4 vs 0 & 4 vs 1 \\
\hline
Leisure activities & 4 & 2 vs 1 & 3 vs 0 & 3 vs 1 & 4 vs 0 \\
\hline
Impact on sleep \\
\hline
Sleeping less than usual & 2 & 2 vs 0 & 2 vs 0 & 2 vs 0 & 2 vs 0 \\
\hline
Difficulty waking up and feeling well rested & 1 & 0 vs 1 & 1 vs 0 & 1 vs 0 & 1 vs 0 \\
\hline
Impact on emotions \\
\hline
Embarrassed & 17 & 5 vs 0 & 5 vs 3 & 8 vs 4 & 12 vs 5 \\
\hline
Annoyed & 7 & 2 vs 2 & 4 vs 2 & 6 vs 1 & 7 vs 0 \\
\hline
Frustrated & 4 & 0 vs 3 & 3 vs 0 & 3 vs 0 & 3 vs 1 \\
\hline
Anxious & 2 & 0 vs 0 & 0 vs 0 & 0 vs 1 & 1 vs 1 \\
\hline
Nervous & 1 & 0 vs 0 & 0 vs 1 & 1 vs 0 & 1 vs 0 \\
\hline
Impact on sex \\
\hline
Sexual activities & 5 & 2 vs 0 & 2 vs 1 & 3 vs 0 & 3 vs 2 \\
\hline
Decreased sexual desire & 2 & 2 vs 0 & 2 vs 0 & 2 vs 0 & 2 vs 0 \\
\hline
\end{tabular}
\end{table} | PMC2717072_table_4 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& & \multicolumn{2}{c|}{\textbf{Sinus rhythm at 12 +- 3 days}} \\
\hline
& \textbf{All} & \textbf{Yes} & \textbf{No} \\
\hline
Patients, n & 111 & 56 & 55 \\
\hline
Age, years & 67 $\pm$ 12 & 66 $\pm$ 11 & 67 $\pm$ 13 \\
\hline
Weight, kg & 86 $\pm$ 20 & 85 $\pm$ 17 & 86 $\pm$ 22 \\
\hline
Length, cm & 178 $\pm$ 9 & 177 $\pm$ 9 & 178 $\pm$ 10 \\
\hline
BMI & 27 $\pm$ 5 & 27 $\pm$ 5 & 27 $\pm$ 5 \\
\hline
Male, n (\%) & 89 (80) & 46 (82) & 43 (78) \\
\hline
AF episode duration, months & 5.8 $\pm$ 8.1 & 4.8 $\pm$ 5.4 & 6.9 $\pm$ 10.1 \\
\hline
First episode of AF, n & 36 & 20 & 16 \\
\hline
Hypothyreosis, n & 2 (2) & 1 (2) & 1 (2) \\
\hline
Hyperthyreosis, n & 2 (2) & 2 (4) & 0 \\
\hline
Hypertension, n & 45 (41) & 26 (46) & 19 (35) \\
\hline
Angina pectoris, n & 18 (16) & 10 (18) & 8 (15) \\
\hline
Previous myocardial infarction, n & 17 (15) & 7 (13) & 10 (18) \\
\hline
Previous CABG, n & 12 (11) & 7 (13) & 5 (9) \\
\hline
Previous PCI, n & 9 (8) & 3 (5) & 6 (11) \\
\hline
Diabetes mellitus, n & 13 (12 & 5 (9) & 8 (15) \\
\hline
Heart failure, n & 25 (23) & 13 (23) & 12 (22) \\
\hline
Dilated cardiomyopathy, n & 11 (10) & 6 (11) & 5 (9) \\
\hline
Hypertrophic cardiomyopathy, n & 3 (3) & 3 (5) & 0 \\
\hline
Stroke, n & 6 (5) & 3 (5) & 3 (5) \\
\hline
TIA, n & 7 (6) & 0 & 7 (13) \\
\hline
Venous thrombosis, n & 1 (1) & 1 (2) & 0 \\
\hline
Pulmonary embolism, n & 1 (1) & 1 (2) & 0 \\
\hline
Peripheral arterial embolism, n & 1 (1) & 1 (2) & 0 \\
\hline
\end{tabular}
\end{table} | PMC2717073_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\multirow{2}{*}{\textbf{New symptoms scale}} & \multirow{2}{*}{\textbf{ICC (AF at 12 $\pm$ 3 days)}} & \multirow{2}{*}{\textbf{Lower 95\% CI limit for ICC}} \\
\hline
\\
\hline
Dyspnoea at rest & 0.82 & 0.61 \\
\hline
Dyspnoea on exertion & 0.88 & 0.72 \\
\hline
Limitations in daily life due to AF & 0.19 & Neg \\
\hline
Discomfort due to AF & 0.04 & Neg \\
\hline
Fatigue due to AF & 0.39 & Neg \\
\hline
Anxiety due to AF & 0.93 & 0.83 \\
\hline
SF-36 domains \\
\hline
Physical functioning & 0.84 & 0.64 \\
\hline
Role – Physical & 0.56 & 0.17 \\
\hline
Bodily pain & 0.50 & 0.09 \\
\hline
General Health & 0.75 & 0.45 \\
\hline
Vitality & 0.77 & 0.49 \\
\hline
Social functioning & 0.54 & 0.14 \\
\hline
Role – Emotional & 0.57 & 0.18 \\
\hline
Mental Health & 0.95 & 0.10 \\
\hline
\end{tabular}
\end{table} | PMC2717073_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Items} & \textbf{Dyspnoea at rest} & \textbf{Dyspnoea on exertion} & \textbf{Limitations in working} & \textbf{Limitations in daily life} & \textbf{Discomfort due to AF} & \textbf{Fatiguedue to AF} & \textbf{Anxiety due to AF} \\
\hline
pf_tran & -0.36437 & -0.58810 & -0.12466 & -0.61232 & -0.20312 & -0.48616 & -0.24267 \\
\hline
Physical functioning & < .0001 & < .0001 & 0.4315 & < .0001 & 0.0325 & < .0001 & 0.0106 \\
\hline
n & 111 & 111 & 42 & 111 & 111 & 111 & 110 \\
\hline
rp_tran & -0.35569 & -0.47634 & -0.20069 & -0.62755 & -0.22794 & -0.49356 & -0.31813 \\
\hline
Role – Physical & 0.0001 & < .0001 & 0.2025 & < .0001 & 0.0171 & < .0001 & 0.0008 \\
\hline
n & 109 & 109 & 42 & 108 & 109 & 109 & 108 \\
\hline
bp_tran & -0.44545 & -0.26582 & -0.34962 & -0.37650 & -0.31149 & -0.32431 & -0.38909 \\
\hline
Bodily Pain & < .0001 & 0.0048 & 0.0232 & < .0001 & 0.0009 & 0.0005 & < .0001 \\
\hline
n & 111 & 111 & 42 & 110 & 111 & 111 & 109 \\
\hline
gh_tran & -0.29357 & -0.27723 & -0.29889 & -0.51705 & -0.31705 & -0.40835 & -0.38909 \\
\hline
General Health & 0.0019 & 0.0034 & 0.0545 & < .0001 & 0.0007 & < .0001 & < .0001 \\
\hline
n & 110 & 110 & 42 & 109 & 110 & 110 & 109 \\
\hline
v_tran & -0.25704 & -0.40008 & -0.40877 & -0.66652 & -0.40433 & -0.66056 & -0.36696 \\
\hline
Vitality & 0.0084 & < .0001 & 0.0120 & < .0001 & < .0001 & < .0001 & 0.0001 \\
\hline
n & 104 & 104 & 37 & 103 & 104 & 104 & 103 \\
\hline
sf_tran & -0.14190 & -0.25434 & -0.08276 & -0.46915 & -0.38437 & -0.42230 & -0.37927 \\
\hline
Social Functioning & 0.1374 & 0.0071 & 0.6023 & < .0001 & < .0001 & < .0001 & < .0001 \\
\hline
n & 111 & 111 & 42 & 110 & 111 & 111 & 110 \\
\hline
re-tran & -0.32767 & -0.37072 & 0.11359 & -0.52260 & -0.21609 & -0.48442 & -0.42472 \\
\hline
Role – Emotional & 0.0004 & < .0001 & 0.4738 & < .0001 & 0.0227 & < .0001 & < .0001 \\
\hline
n & 111 & 111 & 42 & 110 & 111 & 111 & 103 \\
\hline
mh_tran & -0.14611 & -0.21271 & -0.21615 & -0.37553 & -0.40701 & -0.44899 & -0.62826 \\
\hline
Mental Health & 0.1389 & 0.0302 & 0.1988 & < .0001 & < .0001 & < .0001 & < .0001 \\
\hline
n & 104 & 104 & 37 & 103 & 104 & 104 & 103 \\
\hline
\end{tabular}
\end{table} | PMC2717073_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Item number} & \textbf{Raw count} & \textbf{Measure} & \textbf{Realse} & \multicolumn{2}{c|}{\textbf{Infit}} & \multicolumn{2}{c|}{\textbf{Outfit}} & \textbf{Score} \\
\hline
& & & & \textbf{\textbf{MNSQ}} & \textbf{\textbf{ZSTD}} & \textbf{\textbf{MNSQ}} & \textbf{\textbf{ZSTD}} & \textbf{corr.} \\
\hline
AF1 & 108 & 0,41 & 0,08 & 0,98 & -0,1 & 0,99 & 0 & 0,51 \\
\hline
AF3 & 40 & 0,22 & 0,17 & 0,89 & -0,4 & 1,28 & 0,4 & 0,39 \\
\hline
AF7 & 107 & 0,15 & 0,05 & 1,04 & 0,2 & 1,01 & 0 & 0,65 \\
\hline
AF5 & 108 & 0,12 & 0,05 & 1,06 & 0,4 & 1 & 0 & 0,66 \\
\hline
AF4 & 107 & -0,06 & 0,05 & 0,84 & -1,2 & 0,79 & -1,1 & 0,76 \\
\hline
AF2 & 108 & -0,4 & 0,05 & 1,24 & 1,7 & 1,2 & 1,2 & 0,69 \\
\hline
AF6 & 108 & -0,43 & 0,05 & 0,87 & -1 & 0,84 & -1,2 & 0,78 \\
\hline
Mean & 98 & 0 & 0,07 & 0,99 & -0,1 & 1,01 & -0,1 \\
\hline
SD & 24 & 0,29 & 0,04 & 0,13 & 0,9 & 0,16 & 0,8 \\
\hline
\end{tabular}
\end{table} | PMC2717073_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Score} & \textbf{Description} \\
\hline
0 & No lesion \\
\hline
1 & Hyperaemic area with erected pili \\
\hline
2 & Moist, exudative and hyperaemic area with intact epidermis \\
\hline
3 & Exudative area, exposed corium with no signs of healing \\
\hline
4 & Exposed corium but in process of healing, dried-up lesion \\
\hline
5 & Dark brown scab, completely or almost completely healed lesion \\
\hline
\end{tabular}
\end{table} | PMC2717074_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
N° of cases \\
\hline
Total & 68 \\
\hline
Distribution of parity groups (\%) \\
\hline
Primiparous & 75.0 \\
\hline
Multiparous & 25.0 \\
\hline
Distribution of lactation stage groups (\%) \\
\hline
DIM* 0–120 & 35.3 \\
\hline
DIM 121–240 & 38.2 \\
\hline
DIM > 240 & 26.5 \\
\hline
\end{tabular}
\end{table} | PMC2717074_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
& \textbf{Median duration} \\
\hline
No stratification & 42 (36–48) \\
\hline
Stratification \\
\hline
Primiparous & 39 (35–48) \\
\hline
Multiparous & 48 (42–48) \\
\hline
Lactation stage at lesion onset \\
\hline
DIM* 0–120 & 42 (39–56) \\
\hline
DIM 121–240 & 42 (35–48) \\
\hline
DIM > 240 & 41 (35–48) \\
\hline
\end{tabular}
\end{table} | PMC2717074_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{Pre-contrast} & \textbf{Post-contrast} & \textbf{CER*} \\
\hline
Triolein Group (n = 12) & 504 (56.5) & 1793 (229.9) & 2.61 (0.73) \\
\hline
Saline Group (n = 18) & 582 (519.1) & 712 (704.0) & 0.22 (0.37) \\
\hline
\end{tabular}
\end{table} | PMC2717075_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{HPVgenotype} & \textbf{Primer sequences} & \textbf{Amplicon (pb)*} \\
\hline
6/11 & TGC AAG AAT GCA CTG ACC AC TGC ATG TTG TCC AGC AGT GT & 334 \\
\hline
16 & CAC AGT TAT GCA CAG AGC TGC CAT ATA TTC ATG CAA TGT AGG TGT A & 457 \\
\hline
18 & CAC TTC ACT GCA AGA CAT AGA GTT GTG AAA TCG TCG TTT TTC A & 332 \\
\hline
31 & GAA ATT GCA TGA ACT AAG CTC G CAC ATA TAC CTT TGT TTG TCA A & 263 \\
\hline
33 & ACT ATA CAC AAC ATT GAA CTA GTT TTT ACA CGT CAC AGT GCA & 398 \\
\hline
42 & CCC AAA GTA GTG GTC CCA GTT A GAT CTT TCG TAG TGT CGC AGT G & 277 \\
\hline
52 & TAA GGC TGC AGT GTG TGC AG CTA ATA GTT ATT TCA CTT AAT GGT & 229 \\
\hline
58 & GTA AAG TGT GCT TAC GAT TGC GTT GTT ACA GGT TAC ACT TGT & 274 \\
\hline
\end{tabular}
\end{table} | PMC2717078_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\multicolumn{4}{c|}{\textbf{HPV-DNA}} \\
\hline
\textbf{Type n = 18} & \textbf{Carcinogenic risk} & \textbf{Frequency n = 82} & \textbf{\%} \\
\hline
6/11 & LR & 17 & 20.7 \\
\hline
42 & LR & 13 & 15.9 \\
\hline
16 & HR & 13 & 15.9 \\
\hline
18 & HR & 9 & 11 \\
\hline
58 & HR & 5 & 6.1 \\
\hline
31 & HR & 3 & 3.7 \\
\hline
35 & HR & 3 & 3.7 \\
\hline
52 & HR & 3 & 3.7 \\
\hline
51 & HR & 2 & 2.4 \\
\hline
54 & LR & 2 & 2.4 \\
\hline
59 & HR & 2 & 2.4 \\
\hline
26 & PHR & 1 & 1.2 \\
\hline
33 & HR & 1 & 1.2 \\
\hline
34 & HR & 1 & 1.2 \\
\hline
45 & HR & 1 & 1.2 \\
\hline
68 & HR & 1 & 1.2 \\
\hline
70 & LR & 1 & 1.2 \\
\hline
73 & HR & 1 & 1.2 \\
\hline
NC* & - & 3 & 3.7 \\
\hline
\end{tabular}
\end{table} | PMC2717078_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Cohort (n = 223)} & \textbf{Characteristic} & \textbf{aSer/Ser (n = 170)} & \textbf{aSer/Leu (n = 43)} & \textbf{aLeu/Leu (n = 10)} \\
\hline
No (\%) of patients & Co-existing diseases \\
\hline
103 (46.2) & Arterial hypertension & 77 (74.8) & 22 (21.4) & 4 (3.9) \\
\hline
82 (36.8) & Myocardial disease & 67 (81.7) & 14 (17.0) & 1 (1.2) \\
\hline
53 (23.8) & Diabetes & 35 (66.0) & 14 (26.0) & 4 (7.5) \\
\hline
52 (23.3) & Lung pathology & 44 (84.6) & 6 (11.5) & 2 (3.8) \\
\hline
16 (7.2) & Renal pathology & 11 (68.8) & 4 (25.0) & 1 (6.3) \\
\hline
No (\%) of patients & Type of surgery \\
\hline
76 (34.1) & Upper-GI resection & 58 (76.3) & 16 (21.1) & 2 (2.6) \\
\hline
62 (27.8) & Colorectal resection & 46 (74.2) & 12 (19.4) & 4 (6.5) \\
\hline
50 (22.4) & bOther abdominal & 37 (74.0) & 10 (20.0) & 3 (6.0) \\
\hline
15 (6.7) & Thoracic & 11 (73.4) & 3 (20.0) & 1 (6.7) \\
\hline
20 (9.0) & Limb and others & 18 (90.0) & 2 (10.0) & - - \\
\hline
No (\%) of infections & Type of Infection \\
\hline
92 (41.3) & Pneumonia & 68 (73.9) & 20 (21.7) & 4 (4.3) \\
\hline
38 (17.0) & Peritonitis & 27 (71.1) & 9 (23.7) & 2 (5.3) \\
\hline
65 (29.2) & Abscess & 52 (80.0) & 10 (15.4) & 3 (4.6) \\
\hline
4 (1.8) & Urinary tract infections & 3 (75.0) & 1 (25.0) & - - \\
\hline
24 (10.8) & Other & 20 (83.3) & 3 (12.5) & 1 (4.2) \\
\hline
No (\%) of infectionsc & Microorganisms \\
\hline
129 (57.9) & Gram-negative & 97 (75.2) & 25 (19.4) & 7 (5.4) \\
\hline
83 (37.2) & Gram-positive & 60 (72.3) & 18 (21.7) & 5 (6.0) \\
\hline
15 (6.7) & Fungi & 13 (86.7) & 2 (13.3) & - - \\
\hline
31 (13.9) & Polymicrobial & 19 (61.3) & 9 (29.0) & 3 (9.8) \\
\hline
24 (10.8) & Clinically diagnosed & 15 (62.5) & 8 (33.3) & 1 (4.2) \\
\hline
No (\%) of patients & Morbidity and Mortality \\
\hline
114 (51.1) & Sepsis without organ dysfunction & 90 (78.9) & 22 (19.3) & 2 (1.8) \\
\hline
109 (48.9) & Severe sepsis and septic shock & 80 (73.4) & 21 (19.3) & 8 (7.3)d \\
\hline
28 (12.6) & Mortality ICU & 21 (75.0) & 6 (21.4) & 1 (3.6) \\
\hline
34 (15.3) & Mortality hospital & 26 (76.5) & 7 (20.6) & 1 (2.9) \\
\hline
\end{tabular}
\end{table} | PMC2717080_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& & & \multicolumn{3}{c|}{\textbf{\textbf{No.} of individuals with genotype (\%)}} \\
\hline
\textbf{Population and disease} & \textbf{No.} & \textbf{Variant Allele Frequency (\%)} & \textbf{Ser/Ser} & \textbf{Ser/Leu} & \textbf{Leu/Leu} & \textbf{P valuea} \\
\hline
Ghana, delivering women \\
\hline
P. falciparum positive & 541 & 0.1 & 540 (99.8) & 1 (0.2) & 0 (0) & 0.49 \\
\hline
P. falciparum negative & 554 & 0 & 554 (100) & 0 (0) & 0 (0) \\
\hline
Germany \\
\hline
Sepsis patients & 223 & 18.1 & 170 (76.2) & 43 (19.3) & 10 (4.5) & 0.19 \\
\hline
Controls & 188 & 19.2 & 138 (74.4) & 48 (25.5) & 2 (1.1)b \\
\hline
Bangladesh \\
\hline
Leprosy patients & 263 & 16.3 & 186 (70.7) & 68 (25.9) & 9 (3.4) & 0.22 \\
\hline
Controls & 280 & 17.2 & 188 (67.1) & 88 (31.5) & 4 (1.4) \\
\hline
Turkey & & & & & & 0.11 \\
\hline
Leprosy patients & 60 & 10.8 & 47 (78) & 13 (21) & 0 (0) \\
\hline
Controls & 100 & 6.5 & 88 (88) & 11 (11) & 1 (1) \\
\hline
\end{tabular}
\end{table} | PMC2717080_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{6}{c|}{\textbf{Particle size (nm) ($\pm$ SD)}} \\
\hline
\textbf{Samples} & \textbf{N/P = 1} & \textbf{N/P = 3} & \textbf{N/P = 5} & \textbf{N/P = 7} & \textbf{N/P = 1}0 & \textbf{N/P = 1}5 \\
\hline
PCFC-g-PEI/pDNA complexes & 208.05 $\pm$ 15.55 & 211.85 $\pm$ 11.95 & 215.3 $\pm$ 12.2 & 195.35 $\pm$ 6.95 & 161.4 $\pm$ 23.2 & 234.85 $\pm$ 10.25 \\
\hline
PEI/pDNA complexes & 118.5 $\pm$ 2.5 & 88.89 $\pm$ 0.83 & 99.115 $\pm$ 3.885 & 136.35 $\pm$ 4.45 & 159.1 $\pm$ 5.7 & 98.59 $\pm$ 9.81 \\
\hline
\end{tabular}
\end{table} | PMC2717081_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{6}{c|}{\textbf{Zeta potential (mV) ($\pm$ SD)}} \\
\hline
\textbf{Samples} & \textbf{N/P = 1} & \textbf{N/P = 3} & \textbf{N/P = 5} & \textbf{N/P = 7} & \textbf{N/P = 1}0 & \textbf{N/P = 1}5 \\
\hline
PCFC-g-PEI/pDNA complexes & 31.2 $\pm$ 2.1 & 16.75 $\pm$ 0.85 & 1.5125 $\pm$ 0.6575 & 1.38 $\pm$ 0.02 & 0.325 $\pm$ 0.19 & 7.835 $\pm$ 1.675 \\
\hline
PEI/pDNA complexes & 25.15 $\pm$ 0.75 & 21.25 $\pm$ 0.25 & 13 $\pm$ 0.7 & 14.8 $\pm$ 1.5 & 1.855 $\pm$ 0.235 & 0.651 $\pm$ 0.062 \\
\hline
\end{tabular}
\end{table} | PMC2717081_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{Mean} & \textbf{Minimum} & \textbf{Maximum} & \textbf{SD} \\
\hline
Age (year) & 27.12 & 19 & 40 & 4.84 \\
\hline
Gestational age (week) & 33.70 & 5 & 42 & 9.50 \\
\hline
HCHB1 (g/l) & 126.35 & 55 & 163 & 18.02 \\
\hline
LAHB2 (g/l) & 128.45 & 78 & 162 & 14.84 \\
\hline
\end{tabular}
\end{table} | PMC2717084_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Characteristics} & \textbf{\%} \\
\hline
Age group \\
\hline
15–19 & 35.8 \\
\hline
20–24 & 49.2 \\
\hline
25–29 & 12.7 \\
\hline
30 and above & 2.3 \\
\hline
Median age & 21.0 \\
\hline
Marital status \\
\hline
Unmarried & 88.3 \\
\hline
Currently married & 11.7 \\
\hline
Districts \\
\hline
Kathmandu valley (3 districts) & 9.2 \\
\hline
Outside Kathmandu valley (64 districts) & 90.8 \\
\hline
Level of education \\
\hline
Intermediate & 27.7 \\
\hline
Undergraduate & 53.9 \\
\hline
Graduate degree & 18.3 \\
\hline
Type of accommodation \\
\hline
With family & 41.0 \\
\hline
Alone & 19.0 \\
\hline
With friends & 40.0 \\
\hline
Total & 100.0 \\
\hline
N & 573 \\
\hline
\end{tabular}
\end{table} | PMC2717085_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
& \textbf{\%} \\
\hline
Experience of kissing a girl & 57.4 \\
\hline
Experience of dating & 44.5 \\
\hline
Experience of placing hand on a girl's breast & 60.2 \\
\hline
Experience of placing hand on a girl's sex organ & 34.9 \\
\hline
Experience of sexual intercourse & 46.9 \\
\hline
Experience of premarital sex & 39.1 \\
\hline
Having close unmarried friend with experience of premarital sex & 53.0 \\
\hline
N & 573 \\
\hline
\end{tabular}
\end{table} | PMC2717085_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Premarital sex}} & \multicolumn{2}{c|}{\textbf{Total}} \\
\hline
& \textbf{Yes} & \textbf{No} & \textbf{\%} & \textbf{Number} \\
\hline
Age group \\
\hline
15–19 & 34.6 & 65.4 & 100.0 & 205 \\
\hline
20 and above & 41.6 & 58.4 & 100.0 & 368 \\
\hline
Level of education \\
\hline
Intermediate & 35.2 & 64.8 & 100.0 & 159 \\
\hline
Undergraduate & 39.8 & 60.2 & 100.0 & 309 \\
\hline
Graduate degree & 42.9 & 57.1 & 100.0 & 105 \\
\hline
Marital status \\
\hline
Married & 32.8 & 67.2 & 100.0 & 67 \\
\hline
Unmarried & 39.9 & 60.1 & 100.0 & 506 \\
\hline
District \\
\hline
Outside Kathmandu valley & 39.8 & 60.2 & 100.0 & 520 \\
\hline
Kathmandu valley & 32.1 & 67.9 & 100.0 & 53 \\
\hline
Living arrangement \\
\hline
With family & 36.6 & 63.4 & 100.0 & 232 \\
\hline
Alone & 43.4 & 56.6 & 100.0 & 106 \\
\hline
With friends & 39.6 & 60.4 & 100.0 & 235 \\
\hline
Attitude towards female virginity*** \\
\hline
Conservative & 33.4 & 66.6 & 100.0 & 305 \\
\hline
Liberal & 45.5 & 54.5 & 100.0 & 268 \\
\hline
Attitude towards male virginity*** \\
\hline
Conservative & 30.0 & 70.0 & 100.0 & 290 \\
\hline
Liberal & 48.4 & 51.6 & 100.0 & 283 \\
\hline
Family structure \\
\hline
Joint family & 39.6 & 60.4 & 100.0 & 139 \\
\hline
Nuclear family & 38.9 & 61.1 & 100.0 & 434 \\
\hline
Religion* \\
\hline
\textbf{No}n-Hindu & 20.0 & 80.0 & 100.0 & 35 \\
\hline
Hindu & 40.3 & 59.7 & 100.0 & 538 \\
\hline
Has a friend who has experienced premarital sex*** \\
\hline
\textbf{No} & 14.9 & 85.1 & 100.0 & 268 \\
\hline
\textbf{Yes} & 60.3 & 39.7 & 100.0 & 305 \\
\hline
\textbf{Total} & 39.1 & 60.9 & 100.0 & 573 \\
\hline
\end{tabular}
\end{table} | PMC2717085_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
& \textbf{\%} \\
\hline
Below 15 yrs. & 6.7 \\
\hline
15–16 & 25.0 \\
\hline
17–18 & 32.0 \\
\hline
19 or more & 36.3 \\
\hline
Total (age range 10–25 years) & 100.0 \\
\hline
N & 224 \\
\hline
\end{tabular}
\end{table} | PMC2717085_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{How many sex partners did you have (total)?} & \textbf{\%} \\
\hline
One & 45.1 \\
\hline
Two & 23.7 \\
\hline
Three and more & 31.3 \\
\hline
Average number of sex partners & 2.4 \\
\hline
SD & 2.1 \\
\hline
Ranges & 1–15 \\
\hline
Total & 100.0 \\
\hline
N & 224 \\
\hline
\end{tabular}
\end{table} | PMC2717085_table_4 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
& \textbf{\%} \\
\hline
Have you ever had sex with CSW? \\
\hline
Yes & 22.8 \\
\hline
No & 77.2 \\
\hline
Total & 100.0 \\
\hline
N & 224 \\
\hline
How often did you use condom with CSW? \\
\hline
Every act of sexual intercourse & 49.0 \\
\hline
Sometimes & 45.1 \\
\hline
Never & 5.9 \\
\hline
Total & 100.0 \\
\hline
N & 51 \\
\hline
\end{tabular}
\end{table} | PMC2717085_table_5 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{Model I} & \textbf{Model I}I & \textbf{Model I}II \\
\hline
Individual characteristics \\
\hline
Age group \\
\hline
15–19 & 1.0 & 1.0 & 1.0 \\
\hline
20 and above & 1.34 & 1.39 & 1.69* \\
\hline
Level of education \\
\hline
Intermediate & 1.0 & 1.0 & 1.0 \\
\hline
Undergraduate & 0.93 & 0.89 & 0.52* \\
\hline
Graduate degree & 0.88 & 0.79 & 0.48* \\
\hline
Marital status \\
\hline
Married & 1.0 & 1.0 & 1.0 \\
\hline
Unmarried & 1.30 & 1.29 & 1.73 \\
\hline
District \\
\hline
Outside Kathmandu valley & 1.0 & 1.0 & 1.0 \\
\hline
Kathmandu valley & 0.82 & 0.84 & 0.97 \\
\hline
Living arrangement \\
\hline
With family & 1.0 & 1.0 & 1.0 \\
\hline
Alone & 1.32 & 1.39 & 1.28 \\
\hline
With friends & 1.05 & 1.07 & 1.07 \\
\hline
Attitude towards male virginity \\
\hline
Conservative (ref) & 1.0 & 1.0 & 1.0 \\
\hline
Liberal & 2.16*** & 2.15*** & 1.91** \\
\hline
Family characteristics \\
\hline
Family structure \\
\hline
Joint family & & 1.0 & 1.0 \\
\hline
Nuclear family & & 0.91 & 0.81 \\
\hline
Religion \\
\hline
Non-Hindu (ref) & & 1.0 & 1.0 \\
\hline
Hindu & & 2.63* & 2.99* \\
\hline
Peer characteristics \\
\hline
Has close unmarried friend who has experienced premarital sex \\
\hline
No (ref) & & & 1.0 \\
\hline
Yes & & & 9.2*** \\
\hline
Intercept & 0.28 & 0.124 & 0.033 \\
\hline
-2 log likelihood & 741.7 & 736.1 & 611.1 \\
\hline
Cox & Snell R square & 0.043 & 0.052 & 0.238 \\
\hline
\end{tabular}
\end{table} | PMC2717085_table_6 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{Method} & \textbf{Threshold} & \textbf{Clusters} & \textbf{Singletons} & \textbf{Max. cluster size} \\
\hline
Rice & sHYB & N/A & 305 & 0 & 2,533 \\
\hline
\multirow{6}{*}{Rice} & HYB & 1.1 & 2 & 21 & 22,459 \\
\hline
& 1.2 & 50 & 36 & 22,078 \\
\hline
& 1.35 & 853 & 286 & 10,773 \\
\hline
& 1.4 & 1,361 & 528 & 4,052 \\
\hline
& 1.45 & 1,863 & 880 & 359 \\
\hline
& 1.5 & 2,341 & 1,405 & 143 \\
\hline
\multirow{8}{*}{Rice} & RESTR & 1e-8 & 128 & 125 & 21,663 \\
\hline
& 1e-10 & 1,247 & 357 & 258 \\
\hline
& 1e-12 & 1,929 & 855 & 122 \\
\hline
& 1e-15 & 2,959 & 3,007 & 79 \\
\hline
& 1e-17 & 3,421 & 5,799 & 67 \\
\hline
& 1e-20 & 3,085 & 12,399 & 59 \\
\hline
& 1e-25 & 680 & 20,925 & 12 \\
\hline
& 1e-30 & 8 & 22,470 & 2 \\
\hline
Rice & RAND & N/A & 1,901 & 0 & 113 \\
\hline
Barley & sHYB & N/A & 70 & 0 & 1,413 \\
\hline
\multirow{3}{*}{Barley} & HYB & 1.5 & 311 & 141 & 14,471 \\
\hline
& 1.6 & 318 & 211 & 14,375 \\
\hline
& 1.7 & 2,124 & 988 & 2,880 \\
\hline
\end{tabular}
\end{table} | PMC2717093_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{Clones} & \textbf{Contigs} & \textbf{Singl.} & \textbf{Q-contigs} \\
\hline
Rice FPC Standard & 22,486 & 1,918 & 860 & 8 \\
\hline
Rice Comp. sHYB & 22,486 & 2,032 & 1,156 & 6 \\
\hline
Rice Comp. HYB & 22,486 & 2,070 & 2,593 & 3 \\
\hline
Rice Comp. RESTR & 22,486 & 1,918 & 860 & 8 \\
\hline
Rice Comp. RAND & 22,486 & 1,994 & 862 & 6 \\
\hline
Barley FPC Standard & 61,647 & 8,852 & 8,821 & 869 \\
\hline
Barley Comp. sHYB & 61,647 & 9,316 & 10,866 & 601 \\
\hline
Barley Comp. HYB & 61,647 & 9,376 & 13,024 & 489 \\
\hline
\end{tabular}
\end{table} | PMC2717093_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{Assembly score (\%)} & \textbf{Misplaced clones} & \textbf{Misass. contigs} & \textbf{Global ordering} \\
\hline
FPC Standard & 96.43 & 675 & 493 & 0.8252 \\
\hline
Comp. sHYB & 97.67 & 343 & 290 & 0.8496 \\
\hline
Comp. HYB & 99.75 & 10 & 7 & 0.8575 \\
\hline
Comp. RESTR & 96.43 & 675 & 473 & 0.8254 \\
\hline
Comp. RAND & 96.48 & 668 & 492 & 0.8252 \\
\hline
\end{tabular}
\end{table} | PMC2717093_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{MTP clones} & \textbf{Coverage (\%)} & \textbf{Overlaps (\%)} \\
\hline
FPC Standard & 2,791 & 84.89 & 84.31 \\
\hline
Comp. sHYB & 2,874 & 85.66 & 86.94 \\
\hline
Comp. HYB & 2,810 & 85.89 & 94.05 \\
\hline
Comp. RESTR & 2,792 & 84.85 & 84.33 \\
\hline
Comp. RAND & 2,856 & 85.08 & 83.75 \\
\hline
\end{tabular}
\end{table} | PMC2717093_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{TP (\%)} & \textbf{FN (\%)} & \textbf{Singl. (\%)} \\
\hline
Rice FPC Standard & 88.91 & 8.53 & 2.56 \\
\hline
Rice Comp. sHYB & 87.90 & 7.05 & 5.05 \\
\hline
Rice Comp. HYB & 83.87 & 1.90 & 14.23 \\
\hline
Rice Comp. RESTR & 88.91 & 8.53 & 2.56 \\
\hline
Rice Comp. RAND & 87.80 & 9.64 & 2.56 \\
\hline
Rice Manual & 92.09 & 7.26 & 0.65 \\
\hline
Barley Standard & 82.27 & 9.63 & 8.10 \\
\hline
Barley Comp. sHYB & 82.55 & 9.25 & 8.20 \\
\hline
Barley Comp. HYB & 72.55 & 9.06 & 18.40 \\
\hline
\end{tabular}
\end{table} | PMC2717093_table_4 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{3}{c|}{\textbf{Day care attendees (N = 61)}} & \multicolumn{3}{c|}{\textbf{All participants (N = 213)}} \\
\hline
\textbf{Serotype} & \textbf{\textbf{DCC1}} & \textbf{\textbf{DCC2}} & \textbf{\textbf{DCC3}} & \textbf{\textbf{DCC1}} & \textbf{\textbf{DCC2}} & \textbf{\textbf{DCC3}} \\
\hline
9V & 15 & 0 & 0 & 21 & 0 & 0 \\
\hline
18C & 0 & 0 & 13 & 0 & 0 & 20 \\
\hline
3 & 9 & 2 & 6 & 11 & 2 & 6 \\
\hline
19F & 0 & 8 & 0 & 1 & 14 & 1 \\
\hline
15B/C & 2 & 4 & 5 & 3 & 6 & 6 \\
\hline
11A & 1 & 2 & 3 & 1 & 4 & 7 \\
\hline
19A & 7 & 0 & 0 & 8 & 0 & 0 \\
\hline
35F & 3 & 2 & 0 & 3 & 4 & 1 \\
\hline
14 & 0 & 2 & 2 & 0 & 4 & 3 \\
\hline
6B & 1 & 1 & 0 & 1 & 4 & 1 \\
\hline
22 & 0 & 2 & 0 & 0 & 4 & 0 \\
\hline
33 & 2 & 0 & 0 & 3 & 0 & 0 \\
\hline
38 & 2 & 0 & 0 & 2 & 0 & 0 \\
\hline
6A & 1 & 1 & 0 & 1 & 1 & 0 \\
\hline
9N & 0 & 0 & 1 & 0 & 1 & 1 \\
\hline
10 & 1 & 0 & 0 & 1 & 0 & 0 \\
\hline
16 & 1 & 0 & 0 & 1 & 0 & 0 \\
\hline
18B & 0 & 1 & 0 & 0 & 1 & 0 \\
\hline
35B & 0 & 0 & 1 & 0 & 0 & 1 \\
\hline
7 & 0 & 0 & 1 & 0 & 0 & 1 \\
\hline
Non-typables & 0 & 0 & 0 & 0 & 3 & 3 \\
\hline
Total & 45 & 23 & 30 & 57 & 48 & 51 \\
\hline
\end{tabular}
\end{table} | PMC2717096_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Model parameter} & \textbf{Posterior mean} & \textbf{5\% quantile} & 9\textbf{5\% quantile} \\
\hline
κ Community acquisition rate (per month) & 0.0059 & 0.0043 & 0.0077 \\
\hline
βfam Family transmission rate (per month) & 0.36 & 0.23 & 0.52 \\
\hline
βdcc DCC transmission rate (per month) & 0.53 & 0.38 & 0.71 \\
\hline
μ Clearance rate (per month) & 0.69 & 0.64 & 0.75 \\
\hline
θ Competition parameter & 0.68 & 0.35 & 1.10 \\
\hline
η Relative susceptibility (adults vs. children) & 0.41 & 0.28 & 0.58 \\
\hline
δ Relative clearance rate (adults vs. children) & 1.23 & 1.06 & 1.41 \\
\hline
\end{tabular}
\end{table} | PMC2717096_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Vaginal (V19I, V12I, V11I)}} & \multicolumn{2}{c|}{\textbf{Ectocervical (3ECI)}} & \multicolumn{2}{c|}{\textbf{Endocervical (sA2EN)}} \\
\hline
& \textbf{\textbf{\textbf{MOI 10}}} & \textbf{\textbf{\textbf{PBS}}} & \textbf{\textbf{\textbf{MOI 10}}} & \textbf{\textbf{\textbf{PBS}}} & \textbf{\textbf{\textbf{MOI 10}}} & \textbf{\textbf{\textbf{PBS}}} \\
\hline
IL-6 & 127 $\pm$ 13.1* & 69 $\pm$ 1.7 & 63.7 $\pm$ 1.8* & 21.3 $\pm$ 2.4 & 348 $\pm$ 13* & 196 $\pm$ 15 \\
\hline
IL-8 & 1458 $\pm$ 117* & 785 $\pm$ 11.3 & 3304 $\pm$ 300* & 722 $\pm$ 98 & 5e7 $\pm$ 1347* & 6e4 $\pm$ 367 \\
\hline
G-CSF & 261 $\pm$ 46 & 227 $\pm$ 37 & 548 $\pm$ 143 & 779 $\pm$ 122 & 155 $\pm$ 6.2* & 93 $\pm$ 21 \\
\hline
GM-CSF & 24 $\pm$ 1.8* & 8 $\pm$ 3.1 & 16 $\pm$ 2.6 & 10 $\pm$ 1.0 & 160 $\pm$ 9.4* & 45 $\pm$ 12 \\
\hline
MCP-1 & 5.8 $\pm$ 1.4 & 7 $\pm$ 2.1 & 11.4 $\pm$ 1.3 & 10 $\pm$ 3.1 & 7.2 $\pm$ 1.1* & 0.46 $\pm$ 0.02 \\
\hline
\end{tabular}
\end{table} | PMC2717097_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{Primer combinations used} & \textbf{Size of the expected PCR product [bp]} & \textbf{PCR product obtained} \\
\hline
GI1 & GI1–1/GI1–2 & 1,331 & - \\
\hline
GI1* & GI1–2/GI1–3 & 677 & + \\
\hline
GI2 & GI2-1/GI2–2 & 624 & + \\
\hline
GI2* & GI2–3/GI2–4 & 902 & - \\
\hline
GI3 & GI3–1/GI3–2 & 967 & + \\
\hline
GI1+GI2 & GI2–3/GI1–2 & 1,175 & - \\
\hline
GI2+GI3 & GI3-2/GI2-2 & 578 & + \\
\hline
GI2*+GI3 & GI3-3/GI2–4 & 494 & - \\
\hline
GI1–GI3 & GI3-2/GI1–2 & 720 & + \\
\hline
GI4 & GI4-1/GI4-2 & 384 & + \\
\hline
GI5 & GI5-1/GI5-2 & 571 & - \\
\hline
GI6 & GI6-1/GI6-2 & 850 & + \\
\hline
GI7 & GI7-1/GI7-2 & 384 & + \\
\hline
\end{tabular}
\end{table} | PMC2717098_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Designation} & \textbf{DNA-Sequence} \\
\hline
GI1-1 & 5'-TAC GGA CCT TCT CGG CGG-3' \\
\hline
GI1–2 & 5'-GAC CCA AGG CAA GAC GCT G-3' \\
\hline
GI1–3 & 5'-ATT ACC CGC ATT CCC TTG TTG-3' \\
\hline
GI2-1 & 5'-TCG TTG ACC TCG CTC CTC CA-3' \\
\hline
GI2-2 & 5'-TAC GAC AGT TGA CCA CAG TTG-3' \\
\hline
GI2–3 & 5'-CTC TGC CGT CCC TCC TTG-3' \\
\hline
GI2–4 & 5'-TCA AGA CCA TCG TAT AGC GG-3' \\
\hline
GI3-1 & 5'-AGG TCT AGG AAA ACT GGG CGA ATC-3' \\
\hline
GI3-2 & 5'-GTA TTC CTG TGC CTA GAT TGG-3' \\
\hline
GI3–3 & 5'-TCA GCC CCA GCA ACT ATC C-3' \\
\hline
GI4-1 & 5'-ATG AAC ACC CGG CGA CCC-3' \\
\hline
GI4-2 & 5'-GAG CTA ACC TAC TGT CCC AT-3' \\
\hline
GI5-1 & 5'-GTT TTG GGA TGT TTT GAA GCG TG-3' \\
\hline
GI5-2 & 5'-CGG TCG AAG AAG CCA GCA GT-3' \\
\hline
GI6-2 & 5'-GAT AGG GTT CGC TCA CAC GGC-3' \\
\hline
GI6-1 & 5'-CTC CTC CAG CAA CAA TAC GG-3' \\
\hline
GI7-1 & 5'-TTG AGA CGA CTA TGA ACC CAG-3' \\
\hline
GI7-2 & 5'-CGC CCA TTG CCA CGA CCG-3' \\
\hline
Tet1 & 5'-GAC GGC GGC CGC ATC TGG CAA AGC-3' \\
\hline
Tet2 & 5'-ATA CTA GTC ATC GCG TGA TCC TCG CGA A-3' \\
\hline
Tet3 & 5'-ATG AAT TCA ATA CGC CCG AGA CCC GCG-3' \\
\hline
Tet4 & 5'-CAT CTC GAG AAA ACG GTG AAG GCC AGC-3' \\
\hline
tRNA45-1 & 5'-CCG TCT CCA ATC CCA AGG C-3' \\
\hline
tRNA45-2 & 5'-CTG GAA CAA GAA GGC CG C-3' \\
\hline
\end{tabular}
\end{table} | PMC2717098_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{MIC Mutant} & \textbf{Design Score} & \textbf{SEC Binding} \\
\hline
N69Q_Q108L_Q120I_K154S_T155D & -8.1 & + \\
\hline
N69Q_Q120I_K154S_T155D_Y157L & -7.1 & - \\
\hline
N69Q_D72F_K154S_T155D & -7.1 & + \\
\hline
N69Q_Q120I_K154S_T155D & -6 & + \\
\hline
N69Q_D72F_Q108L_K152V_Y157L & -5.9 & + \\
\hline
K152V_K154S_T155D_Y157L & -5.8 & + \\
\hline
N69Q_K154D & -4.3 & + \\
\hline
K154S_T155D & -4 & - \\
\hline
K152V_K154S_T155D & -3.9 & - \\
\hline
N69Q_D72F_Q108L & -3.9 & + \\
\hline
N69Q_D72F & -3.6 & + \\
\hline
N69Q & -2.8 & + \\
\hline
K152V_Y157L & -2.2 & + \\
\hline
K154D & -1.5 & + \\
\hline
Q108L & -0.5 & + \\
\hline
Wild-type & 0 & + \\
\hline
D72W & 0.3 & - \\
\hline
Q120I & 0.7 & + \\
\hline
Q120I_K154M & 0.8 & n/a \\
\hline
N69W & 1.8 & ++ \\
\hline
N69W_K152E_K154S & 4.2 & ++ \\
\hline
N69W_K152E_K154D & 4.3 & ++ \\
\hline
K152E_K154M & 4.4 & + \\
\hline
N69W_D72F_K152E & 4.5 & ++ \\
\hline
N69W_D72W_K152E & 5.1 & + \\
\hline
N69W_K152E & 5.5 & ++ \\
\hline
\end{tabular}
\end{table} | PMC2717102_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Origin} & \textbf{Sequence} & \textbf{Reference} \\
\hline
Plasma proteins \\
\hline
Complement factor C3 & LGEACKKVFLDCCNYITELRRQHARAS & [13,14] \\
\hline
High molecular weight kininogen & HKHGHGHGKHKNKGKKNGKH & [15] \\
\hline
Fibronectin & QPPRARITGYIIKYEKPG & [17] \\
\hline
Protein C Inhibitor & SEKTLRKWLKMFKKRQLELY & [11] \\
\hline
Histidine-rich glycoprotein & GHHPHGHHPHGHHPHGHHPH & [18,19] \\
\hline
Extracellular proteins \\
\hline
Amphiregulin & LKKNGSCKRGPRTHYGQKAIL & [17] \\
\hline
Heparin-binding EGF-like growth factor & GKRKKKGKGLGKKRDPCLRKYK & [17] \\
\hline
Fibroblast growth factor \\
\hline
Hepatocyte growth factor & LKIKTKKVNTADQCANRCTRNKGL \\
\hline
Vitronectin & AKKQRFRHRNRKGYR & [11] \\
\hline
PRELP & QPTRRPRPGTGPGRRPRPRPRP & [17] \\
\hline
Laminin chains & SRNLSEIKLLISQARK KDFLSIELFRGRVKV LGTRLRAQSRQRSRPGRWHKVSVRW RLRAQSRQRSRPGRWHKVSVRW & [11] \\
\hline
\end{tabular}
\end{table} | PMC2717103_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Causes} & \textbf{number} & \textbf{\%} \\
\hline
$\geq$ BMI** 30 kg/m2 & 3 & 6.8 \\
\hline
PEGs suture-free technique & 6 & 13.6 \\
\hline
PEGs could not be performed \\
\hline
Non dilatable stenosis & 26 & 59.1 \\
\hline
Neoplasias affecting stomach & 3 & 6.8 \\
\hline
Gastric ulcer perforation & 2 & 4.5 \\
\hline
Patients with ascites & 2 & 4.5 \\
\hline
Partial gastrectomy & 1 & 2.3 \\
\hline
Respiratory failure associated to supine position & 1 & 2.3 \\
\hline
\end{tabular}
\end{table} | PMC2717113_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Variable} & \textbf{number} & \textbf{\%} \\
\hline
Gender \\
\hline
Male & 354 & 81.4 \\
\hline
Female & 81 & 18.6 \\
\hline
Baseline disease \\
\hline
Head/Neck neoplasia & 346 & 79.5 \\
\hline
Esophagus neoplasia & 74 & 17.0 \\
\hline
Lung neoplasia & 9 & 2.1 \\
\hline
Neurologic disease & 6 & 1.4 \\
\hline
Indication \\
\hline
Dysphagia & 346 & 79.5 \\
\hline
Preoperative & 57 & 13.1 \\
\hline
Salivary fistula & 22 & 5.1 \\
\hline
Nasal regurgitation & 10 & 2.3 \\
\hline
Minor complications \\
\hline
Bleeding & 4 & 0.9 \\
\hline
Respiratory failure & 3 & 0.7 \\
\hline
Major complications \\
\hline
Pneumoperitoneum & 2 & 0.5 \\
\hline
Leakage & 2 & 0.5 \\
\hline
Wound infection & 1 & 0.2 \\
\hline
Mortality & 1 & 0.2 \\
\hline
\end{tabular}
\end{table} | PMC2717113_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Author [ref]} & \textbf{Year} & \textbf{Gastropexy} & \textbf{Antibiotics} & \textbf{N} & Infection (\textbf{N}) & \textbf{Infection (\%)} \\
\hline
Russell TR [12] & 1984 & \textbf{N}o & \textbf{N}/A & 28 & 1 & 3.6 \\
\hline
Hashiba K [19] & 1987 & Suture & \textbf{N}/A & 56 & 0 & 0.0 \\
\hline
Kadota T [13] & 1991 & \textbf{N}o & \textbf{N}/A & 89 & 3 & 3.4 \\
\hline
Robertson FM [18] & 1996 & Fogarty & Yes & 20 & 0 & 0.0 \\
\hline
Tucker AT [16] & 2003 & T-fastener & Yes & 29 & 0 & 0.0 \\
\hline
Maetani I [4] & 2003 & \textbf{N}o & Yes & 29 & 0 & 0.0 \\
\hline
Dormann AJ [9] & 2006 & Suture & Yes & 46 & 1 & 2.2 \\
\hline
Saito M [11] & 2007 & Suture & \textbf{N}/A & 82 & 0 & 0.0 \\
\hline
Campoli PMO [8] & 2007 & Suture & \textbf{N}o & 142 & 4 & 2.8 \\
\hline
Toyama Y [20] & 2007 & Suture & Yes & 30 & 1 & 3.3 \\
\hline
Foster JM [17] & 2007 & T-fastener & \textbf{N}o & 149 & 5 & 3.4 \\
\hline
Shastri YM [14] & 2008 & Suture & Yes & 47 & 1 & 2.1 \\
\hline
Shastri YM [14] & 2008 & Suture & \textbf{N}o & 46 & 1 & 2.2 \\
\hline
Horiuchi A [5] & 2008 & Suture & Yes & 68 & 0 & 0.0 \\
\hline
Current series & 2008 & Suture & \textbf{N}o & 435 & 1 & 0.2 \\
\hline
Pooled & & & & 1,296 & 18 & 1.4 [95\%CI: 0.9–2.2] \\
\hline
\end{tabular}
\end{table} | PMC2717113_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Characteristics} & \textbf{Population*} & \textbf{Episodes} & \textbf{Period prevalence (\%) [95\% CI]} \\
\hline
& 1,004 & 170 & 16.9 [14.7–19.4] \\
\hline
Gender \\
\hline
Female & 524 & 89 & 17 [13.9–20.5] \\
\hline
Male & 480 & 81 & 16.9 [13.6–20.5] \\
\hline
Age group (Years) \\
\hline
0–4 & 139 & 28 & 20.1 [13.8–27.8] \\
\hline
5–9 & 131 & 9 & 6.9 [3.2–12.6] \\
\hline
10–14 & 112 & 10 & 8.9 [4.4–15.8] \\
\hline
15 + & 622 & 123 & 19.8 [16.7–23.1] \\
\hline
\end{tabular}
\end{table} | PMC2717114_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Alabama} & \textbf{0.309} & \textbf{Montana} & \textbf{0.277} \\
\hline
Alaska & 0.226 & North Carolina & 0.31 \\
\hline
Arkansas & 0.362 & North Dakota & 0.217 \\
\hline
Arizona & 0.304 & Nebraska & 0.209 \\
\hline
California & 0.27 & New Hampshire & 0.152 \\
\hline
Colorado & 0.21 & New Jersey & 0.167 \\
\hline
Connecticut & 0.18 & New Mexico & 0.32 \\
\hline
District of Columbia & 0.288 & Nevada & 0.229 \\
\hline
Delaware & 0.207 & New York & 0.28 \\
\hline
Florida & 0.266 & Ohio & 0.235 \\
\hline
Georgia & 0.264 & Oklahoma & 0.308 \\
\hline
Hawaii & 0.185 & Oregon & 0.249 \\
\hline
Iowa & 0.21 & Pennsylvania & 0.212 \\
\hline
Idaho & 0.278 & Rhode Island & 0.217 \\
\hline
Illinois & 0.228 & South Carolina & 0.3 \\
\hline
Indiana & 0.233 & South Dakota & 0.234 \\
\hline
Kansas & 0.231 & Tennessee & 0.288 \\
\hline
Kentucky & 0.322 & Texas & 0.325 \\
\hline
Louisiana & 0.336 & Utah & 0.25 \\
\hline
Massachusetts & 0.212 & Virginia & 0.197 \\
\hline
Maryland & 0.154 & Vermont & 0.19 \\
\hline
Maine & 0.243 & Washington & 0.189 \\
\hline
Michigan & 0.245 & Wisconsin & 0.187 \\
\hline
Minnesota & 0.18 & West Virginia & 0.332 \\
\hline
Missouri & 0.264 & Wyoming & 0.209 \\
\hline
Mississippi & 0.413 \\
\hline
\end{tabular}
\end{table} | PMC2717116_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Prostasin} & \textbf{Healthy} & \textbf{Cases} \\
\hline
& & Adenomas1 & & Carcinomas \\
\hline
& & Mild/moderate dysplasia & Severe dysplasia \\
\hline
& (n = 23) & (n = 93) & (n = 13) & (n = 116) \\
\hline
Men & 9 & 68 & 7 & 59 \\
\hline
Women & 14 & 25 & 6 & 57 \\
\hline
Mean age +SD2 & 56.3 $\pm$ 4.6 & 57.3 $\pm$ 3.5 & 54.8 $\pm$ 3.1 & 68.7 $\pm$ 12.4 \\
\hline
\end{tabular}
\end{table} | PMC2717118_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Variable} & \textbf{mRNA level in normal tissue Mean (SD)} & \textbf{\textbf{Pa}} & \textbf{mRNA level in adenomas/ carcinomas Mean (SD)} & \textbf{\textbf{Pa}} & \textbf{Pb} \\
\hline
Prostasin \\
\hline
Healthy individuals & 0.96 (0.29) \\
\hline
Mild/moderate & 1.10 (0.38) & NS & 0.62 (0.24) & NS & <0.001 \\
\hline
Severe & 1.08 (0.46) & NS & 0.73 (0.50) & NS & <0.01 \\
\hline
\multirow{2}{*}{Carcinoma distant adjacent} & 0.85 (0.65) & NS & 0.61 (0.60) & NS & <0.05 \\
\hline
0.90 (0.76) & NS & & & <0.01 \\
\hline
All adenomas and carcinomas & 0.96 (0.61) & NS & 0.62 (0.48) & <0.05 & ND \\
\hline
PN-1 \\
\hline
Healthy individual & 0.022 (0.030) \\
\hline
Mild/moderate & 0.015 (0.017) & NS & 0.041 (0.028) & NS & <0.001 \\
\hline
Severe & 0.010 (0.003) & NS & 0.033 (0.031) & NS & <0.05 \\
\hline
\multirow{2}{*}{Carcinoma distant adjacent} & 0.028 (0.027) & NS & 0.063 (0.060) & <0.001 & <0.001 \\
\hline
0.025 (0.018) & NS & & & <0.001 \\
\hline
\end{tabular}
\end{table} | PMC2717118_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Probeset typea} & \textbf{Number of probesets} \\
\hline
Total number of probesets & 61115 \\
\hline
Cross-hybridizing (_s_at,_x_at,_a_at) & 12704 \\
\hline
Ambiguous orientation (A1) & 10643 \\
\hline
Members of 5' (i.e. "prune") set & 32578 \\
\hline
"High quality" probesets & 13822 \\
\hline
\end{tabular}
\end{table} | PMC2717122_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Gene} & \textbf{Forward primer} & \textbf{Reverse primer} & \textbf{Product size (bp)} \\
\hline
ELF1 & CAGATTGGCAACGGCTACG & CGGACAGCAAAACGACCAAG & 227 \\
\hline
GAPDH & TTCAACATCATTCCAAGCAGCA & CGTAACCCAAAATGCCCTTG & 220 \\
\hline
Cyclophilin & CAAGCCGCTGCACTACAAGG & AGGGGACGGTGCAGATGAA & 227 \\
\hline
Actin & GACAATGGAACCGGAATGGTC & GTGTGATGCCAGATTTTCTCCAT & 236 \\
\hline
\end{tabular}
\end{table} | PMC2717122_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Probeset} & \textbf{Forward primer} & \textbf{Reverse primer} & \textbf{Product size (bp)} \\
\hline
Barley1 \\
\hline
Contig8230 & TACATGCTCTTGTTTGGTGCTACTG & AAGGTAAGTAGGCAGCAGTGAAGGT & 204 \\
\hline
Contig6943 & GGGGAAATCCCAGGTCGTCGAT & GGCTTGCTGCTAGGGTTTTCAG & 266 \\
\hline
Contig7925 & CGAACCGTAGAATGTGTAAGGG & GGGAGGAAAGATACACGCTT & 114 \\
\hline
Contig3031 & TTACTATGCTGGATATGGACAAGGG & TCTCATCTCATGTCTGGAAGACCC & 190 \\
\hline
Contig4668 & CCCCCCACAAGTACCTGAAGA & CGTTGGCTTGCTTAGCTCTTCC & 286 \\
\hline
Contig7671 & CTAAGCGACCTTGCATCTTTTGAC & AACGCTAGTGCTACTGGCAGGA & 213 \\
\hline
Contig20269 & GAAGGCTCAGAAAGTTGCTGCTAT & GCAAAATCATTCACTGCTTCCAGAG & 224 \\
\hline
Contig5740 & GAGGCTGTTCAGCAACTGGACTG & CAAGGATCCCAGCCACATACTG & 227 \\
\hline
Contig15148 & GATCTCTTCGTGGTGGATCACATAC & GCTTGATGTCCTATGCTTTCCAA & 221 \\
\hline
Contig11660 & ACCTCATCAACCTCTGCGGC & TTCCAGAGAACGGAGGCAGG & 210 \\
\hline
Contig14399 & AGAAAGAGAGATTTTGAAGCTTGGC & AATCCATCGCCATGCCAACT & 213 \\
\hline
Contig15147 & GGCGGGGCACTTTTGAGGACAT & CGAGCCTGCGACGGGTTATT & 182 \\
\hline
Contig2400 & AAGCATGCCGCCATCCCGTT & CCCAACCTGACAACTCCACCTAGA & 244 \\
\hline
Wheat \\
\hline
Ta.3039.1 & ACGTCCATAACGATGGTCTTCATTG & GTAGTGGCCTCAGCATCACCATTGC & 170 \\
\hline
Ta.13729.1 & TTTTCTACATGCTCTTGTTTGGTGC & AAAAGATCAACCCATGTGCTGCTCC & 265 \\
\hline
Ta.27013.1 & CGAAGCGTGTATCTTTCCTC & CAGACACAAACGAAAATGAC & 183 \\
\hline
Ta.7602.1 & AGCCCCCCACAAGTACCTGATGATG & GTCGTCATCCTCGTCACCATCTTCC & 201 \\
\hline
Ta.27369.1 & TTACTATGCTGGATATGGACAAGGC & TGCTACAACATTAGCCTTGACAGTG & 230 \\
\hline
Ta.9536.1 & GCCCTAAACGACCTTGCATCTTTTG & AAACTGAAGCACTAACCTACGACGC & 236 \\
\hline
Ta.968.1 & ATGTGCTGCGTCGTCAGATACATAG & TACCCTCCTCGACTTCCTTGTGATC & 204 \\
\hline
Ta.4425.1 & GATGCCATCAGATCCTCCAATT & GCCACTCCGTTGTGTCATAATATGG & 235 \\
\hline
Ta.27038.1 & CGAAGCGTGTATCTTTCCTC & CAGACACAAACGAAAATGAC & 151 \\
\hline
Ta.7256.1 & CATCTCATGGTACCTGACTGTCGA & GCAACAGACTGCCACCAGCA & 264 \\
\hline
TaAffx.46790.1 & TCATGTCAGTTTATTGCAAGG & CAGTGACACTATAACAATACAGTTCT & 240 \\
\hline
TaAffx.128707.1 & GAAAAGGTTGTAGTTCAGAAGG & TTGCTCTGGACTACTGTCTTC & 259 \\
\hline
\end{tabular}
\end{table} | PMC2717122_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& & & \textbf{\% Frequency} & & \multicolumn{2}{c|}{\textbf{Fisher’s exact}} \\
\hline
\textbf{Genes} & \textbf{Method} & \textbf{PT} & \textbf{PN} & \textbf{NN} & \textbf{ap value} & \textbf{bp value} \\
\hline
B4GALT1 & C-MSP & 100 (5/5) & 0 (0/5) & 0 (0/5) & 0.008* & 0.008*! \\
\hline
C10orf119 & SEQ & 0 (0/10) & 0 (0/10) & 0/10 & n/a & n/a \\
\hline
COPS4 & SEQ & 0 (0/5) & 0 (0/5) & 0 (0/5) & n/a & n/a \\
\hline
CSRP1 & SEQ & 50 (3/6) & 90 (9/10) & 100 (5/5) & 0.118 & 0.182 \\
\hline
DARS & SEQ & 22 (2/9) & 40 (4/10) & 40 (4/10) & 0.628 & 0.628 \\
\hline
FKBP14 & SEQ & 0 (0/5) & 0 (0/5) & 0 (0/4) & n/a & n/a \\
\hline
FN3KRP & SEQ & 100 (5/5) & 100 (5/5) & 100 (5/5) & n/a & n/a \\
\hline
FLJ20277 & SEQ & 100 (5/5) & 100 (5/5) & 100 (5/5) & n/a & n/a \\
\hline
HUS1 & SEQ & 22 (2/9) & 0 (0/5) & 0 (0/5) & 0.505 & 0.505 \\
\hline
KLF11 & SEQ & 100 (6/6) & 100 (6/6) & 100 (6/6) & n/a & n/a \\
\hline
MYBL2 & SEQ & 100 (9/9) & 70 (7/10) & 100 (5/5) & 0.6 & n/a \\
\hline
MRPL4 & SEQ & 100 (5/5) & 100 (5/5) & 100 (5/5) & n/a & n/a \\
\hline
MYLK & SEQ & 10 (1/10) & 0 (0/10) & 0 (0/10) & 1.000 & 1.000 \\
\hline
OSMR & C-MSP & 100 (5/5) & 33 (1/3) & 0 (0/5) & 0.107 & 0.008*! \\
\hline
PAPSS2 & SEQ, C-MSP & 100 (5/5) & 20 (1/5) & 0 (0/5) & 0.048* & 0.008*! \\
\hline
RBMS2 & SEQ & 100 (10/10) & 100 (7/7) & 100 (10/10) & n/a & n/a \\
\hline
SECTM1 & SEQ & 0 (0/5) & 0 (0/5) & 0 (0/5) & n/a & n/a \\
\hline
SIRT7 & SEQ & 100 (4/4) & 100 (5/5) & 100 (3/3) & n/a & n/a \\
\hline
SLC39A4 & SEQ, C-MSP & 67 (6/9) & 100 (6/6) & 100 (10/10) & 0.229 & 0.087 \\
\hline
SLC9A3R1 & C-MSP & 100 (5/5) & 100 (5/5) & 100 (5/5) & n/a & n/a \\
\hline
TUBG2 & SEQ, C-MSP & 71 (5/7) & 40 (2/5) & 0 (0/5) & 0.558 & 0.028*! \\
\hline
NTRK2 & C-MSP & 100 (5/5) & 20 (1/5) & 0 (0/5) & 0.048* & 0.008*! \\
\hline
SFRP4 & C-MSP & 100 (5/5) & 0 (0/5) & 0 (0/5) & 0.008* & 0.008*! \\
\hline
\end{tabular}
\end{table} | PMC2717211_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{3}{c|}{\textbf{SFRP1}} & \multicolumn{3}{c|}{\textbf{B4GALT1}} & \multicolumn{3}{c|}{\textbf{OSMR}} & \multicolumn{3}{c|}{\textbf{SFRP1}+\textbf{OSMR}d} \\
\hline
\textbf{Clinical features} & \textbf{\textbf{\textbf{\textbf{(+) M}}}} & \textbf{\textbf{\textbf{\textbf{\%}}}} & \textbf{\textbf{\textbf{\textbf{P value}}}} & \textbf{\textbf{\textbf{\textbf{(+) M}}}} & \textbf{\textbf{\textbf{\textbf{\%}}}} & \textbf{\textbf{\textbf{\textbf{P value}}}} & \textbf{\textbf{\textbf{\textbf{(+) M}}}} & \textbf{\textbf{\textbf{\textbf{\%}}}} & \textbf{\textbf{\textbf{\textbf{P value}}}} & \textbf{\textbf{\textbf{\textbf{(+) M}}}} & \textbf{\textbf{\textbf{\textbf{\%}}}} & \textbf{\textbf{\textbf{\textbf{P value}}}} \\
\hline
Non-CRC/Non-ADa & 0/15 & 0 & e0.001* & 2/10 & 20 & e0.109 & 0/15 & 0 & e0.004* & 0/15 & 0 & e,0.001* \\
\hline
CRCb & 11/20 & 55 & & 9/16 & 56 & & 9/20 & 45 & & 12/20 & 60 \\
\hline
ADc & 5/17 & 29 & f0.185 & & n/a & & 2/16 & 13 & f0.067 & 6/17 & 35 & f0.191 \\
\hline
\end{tabular}
\end{table} | PMC2717211_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Clinical features} & \textbf{(+) M} & \textbf{\%} & \textbf{eP value} & \textbf{fP value} \\
\hline
Controlsa & 4/81 & 5 \\
\hline
CRCb \\
\hline
Total & 26/69 & 38 & ,0.001* \\
\hline
Stagec I & 2/18 & 11 & 0.299 \\
\hline
II & 15/27 & 56 & ,0.001* \\
\hline
III & 8/18 & 44 & ,0.001* \\
\hline
IV & 1/6 & 17 & 0.307 \\
\hline
controlsd Confounding & 7/41 & 17 & & 0.031 \\
\hline
\end{tabular}
\end{table} | PMC2717211_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Tissues} & \textbf{Expression} & \textbf{Tumor Grade} \\
\hline
Colon Cancer \\
\hline
1 & - & III \\
\hline
2 & - & III \\
\hline
3 & - & III \\
\hline
4 & + & III \\
\hline
5 & + & II \\
\hline
6 & - & II \\
\hline
7 & - & II \\
\hline
8 & - & I \\
\hline
9 & + & I \\
\hline
10 & + & I \\
\hline
Non-malignant normal colon \\
\hline
1 & ++ \\
\hline
2 & ++++ \\
\hline
3 & ++++ \\
\hline
4 & ++++ \\
\hline
5 & ++++ \\
\hline
6 & ++++ \\
\hline
Cancer adjacent normal colon \\
\hline
1 & ++++ \\
\hline
2 & ++++ \\
\hline
3 & ++++ \\
\hline
4 & ++++ \\
\hline
5 & ++++ \\
\hline
6 & ++++ \\
\hline
7 & ++++ \\
\hline
8 & ++++ \\
\hline
\end{tabular}
\end{table} | PMC2717211_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Among Total Sample}} & \multicolumn{3}{c|}{\textbf{Among Ideators}} \\
\hline
\textbf{DSM-IV Disorders} & \textbf{Ideation} & \textbf{Attempt} & \textbf{Plan} & \textbf{Plan}ned \textbf{Attempt} & Unplanned \textbf{Attempt} \\
\hline
Any mood disorder & 0.620 & 0.586 & 0.007 & 0.073 & 0.056 \\
\hline
Any anxiety disorder & 0.293 & 0.326 & 0.015 & 0.086 & 0.045 \\
\hline
Any impulse disorder & 0.072 & 0.064 & 0.003 & 0.009 & 0.029 \\
\hline
Any substance disorder & 0.132 & 0.135 & 0.015 & 0.022 & 0.064 \\
\hline
Any disorder & 0.761 & 0.753 & 0.047 & 0.187 & 0.176 \\
\hline
(n)a & (27,963) & (27,963) & (4,997) & (1,874) & (3,123) \\
\hline
\end{tabular}
\end{table} | PMC2717212_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Among Total Sample}} & \multicolumn{3}{c|}{\textbf{Among Ideators}} \\
\hline
\textbf{DSM-IV Disorders} & \textbf{Ideation} & \textbf{Attempt} & \textbf{Plan} & \textbf{Plan}ned \textbf{Attempt} & Unplanned \textbf{Attempt} \\
\hline
Any mood disorder & 0.421 & 0.400 & 20.021 & 0.008 & 20.031 \\
\hline
Any anxiety disorder & 0.217 & 0.231 & 0.010 & 0.024 & 0.079 \\
\hline
Any impulse disorder & 0.111 & 0.097 & 0.007 & 0.009 & 0.023 \\
\hline
Any substance disorder & 0.114 & 0.098 & 0.009 & 0.013 & 0.034 \\
\hline
Any disorder & 0.609 & 0.592 & 0.003 & 0.055 & 0.102 \\
\hline
(n)a & (26,959) & (26,959) & (3,326) & (1,438) & (1,888) \\
\hline
\end{tabular}
\end{table} | PMC2717212_table_1 |
End of preview. Expand in Data Studio
README.md exists but content is empty.
- Downloads last month
- 9