Dataset Viewer
Auto-converted to Parquet Duplicate
image
imagewidth (px)
205
980
latex
stringlengths
132
39.9k
filename
stringlengths
18
19
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|} \hline \textbf{Name} & \textbf{Description} \\ \hline C2 & complement component 2 \\ \hline PMP22 & peripheral myelin protein 22 \\ \hline SDC1 & syndecan 1 \\ \hline COL11A1 & collagen, type XI, alpha 1 \\ \hline ITGB4 & integrin, beta 4 \\ \hline DCN & decorin \\ \hline THBS4 & thrombospondin 4 \\ \hline COL1A1 & collagen, type I, alpha 1 \\ \hline IFIT1 & interferon-induced protein with tetratricopeptide repeats 1 \\ \hline LUM & lumican \\ \hline MMP9 & matrix metalloproteinase 9 \\ \hline COL3A1 & collagen, type III, alpha 1 \\ \hline COL1A2 & collagen, type I, alpha 2 \\ \hline JAK1 & Janus kinase 1 \\ \hline MMP12 & matrix metalloproteinase 12 \\ \hline TNFSF10 & tumour necrosis factor (ligand) superfamily, member 10 \\ \hline HSPA4 & heat shock 70 kDa protein 4 \\ \hline FBLN2 & fi bulin 2 \\ \hline SFRP2 & secreted frizzled-related protein 2 \\ \hline COL15A1 & collagen, type XV, alpha 1 \\ \hline FBLN1 & fi bulin-1 \\ \hline GEM & GTP binding protein \\ \hline MATN2 & matrilin 2 \\ \hline CCL21 & chemokine (C-C motif) ligand 21 \\ \hline CCL19 & chemokine (C-C motif) ligand 19 \\ \hline SLCO2A1 & solute carrier organic anion transporter family, member 2A1 \\ \hline MFAP5 & microfi brillar-associated protein 5 \\ \hline CXCL14 & chemokine (C-X-C motif) ligand 14 \\ \hline PRG4 & proteoglycan 4 \\ \hline CCL13 & chemokine (C-C motif) ligand 13 \\ \hline CCL14 & chemokine (C-C motif) ligand 14 \\ \hline CCL15 & chemokine (C-C motif) ligand 15 \\ \hline \end{tabular} \end{table}
PMC2716678_table_3
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|} \hline & \textbf{True normal tissues} & \textbf{True tumor tissues} \\ \hline Predicted as normal tissues & 1 & 1 \\ \hline Predicted as tumor tissues & 5 & 41 \\ \hline \end{tabular} \end{table}
PMC2716681_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|} \hline & & Batch I Analysis \\ \hline & Organ donor (N) & Adjacent to tumor (A) & Tumor (T) & Total \\ \hline Liver & 21 & 30 & 43 & 94 \\ \hline Prostate & 23 & 59 & 66 & 148 \\ \hline & & Batch II Analysis \\ \hline & Organ donor (N) & Tumor (T) & & Total \\ \hline Liver & 21 & 43 & & 64 \\ \hline Prostate & 23 & 66 & & 89 \\ \hline Lung & 17 & 134 & & 151 \\ \hline Bladder & 5 & 57 & & 62 \\ \hline \end{tabular} \end{table}
PMC2716681_table_1
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|} \hline & \multicolumn{2}{c|}{Liver vs. Prostate} \\ \hline & liv→liv & pro→liv & pro→pro & liv→pro \\ \hline All genes & 96.5\% & 66.3\% & 93.9\% & 47.4\% \\ \hline Common signature & 96.5\% & 93.0\% & 98.8\% & 96.3\% \\ \hline & \multicolumn{2}{c|}{Liver vs. Prostate} \\ \hline All genes & 92.6\% & 77.9\% & 96.6\% & 54.6\% \\ \hline Common signature & 98.2\% & 96.0\% & 98.3\% & 96.6\% \\ \hline & \multicolumn{2}{c|}{Liver vs. Prostate} \\ \hline All genes & 79.9\% & 51.9\% & 71.4\% & 55.7\% \\ \hline Common signature & 75.6\% & 74.7\% & 66.7\% & 65.1\% \\ \hline \end{tabular} \end{table}
PMC2716681_table_2
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|} \hline & \multicolumn{2}{c|}{Liver} \\ \hline & liv→liv & pro→liv & pro→pro & liv→pro \\ \hline All genes & 96.51\% & 66.28\% & 93.94\% & 47.36\% \\ \hline Common signature & 97.67\% & 97.67\% & 95.55\% & 94.14\% \\ \hline & \multicolumn{2}{c|}{Liver} \\ \hline & liv→liv & lun→liv & lun→lun & liv→lun \\ \hline All genes & 96.51\% & 56.98\% & 90.72\% & 45.32\% \\ \hline Common signature & 95.23\% & 93.02\% & 95.94\% & 94.72\% \\ \hline & \multicolumn{2}{c|}{Lung} \\ \hline & lun→lun & pro→lun & pro→pro & lun→pro \\ \hline All genes & 90.72\% & 69.03\% & 93.94\% & 62.88\% \\ \hline Common signature & 94.82\% & 94.45\% & 79.61\% & 72.76\% \\ \hline & \multicolumn{2}{c|}{Liver} \\ \hline & liv→liv & bla→liv & bla→bla & liv→bla \\ \hline All genes & 96.51\% & 62.79\% & 88.60\% & 49.65\% \\ \hline Common signature & 91.74\% & 91.86\% & 98.25\% & 98.25\% \\ \hline & \multicolumn{2}{c|}{Prostate} \\ \hline & pro→pro & bla→pro & bla→bla & pro→bla \\ \hline All genes & 93.94\% & 36.30\% & 88.60\% & 42.63\% \\ \hline Common signature & 92.92\% & 86.86\% & 97.81\% & 88.25\% \\ \hline & \multicolumn{2}{c|}{Lung} \\ \hline & lun→lun & bla→lun & bla→bla & lun→bla \\ \hline All genes & 90.72\% & 51.87\% & 88.60\% & 50.88\% \\ \hline Common signature & 89.38\% & 85.91\% & 97.37\% & 85.61\% \\ \hline \end{tabular} \end{table}
PMC2716681_table_3
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|} \hline & & \multicolumn{4}{c|}{\textbf{Test data}} \\ \hline & & \textbf{Liver} & \textbf{Prostate} & \textbf{Lung} & \textbf{Bladder} \\ \hline \multirow{4}{*}{Training data} & \textbf{Liver} & 96.5\% (69)* & (225)+ 94.1\% & (119)+ 94.7\% & (53)+ 98.3\% \\ \hline \textbf{Prostate} & (225)+ 97.7\% & 93.9\% (55)* & (288)+ 94.5\% & (10)+ 88.3\% \\ \hline \textbf{Lung} & (119)+ 93.0\% & (288)+ 72.8\% & 90.7\% (57)* & (19)+ 85.6\% \\ \hline \textbf{Bladder} & (53)+ 91.9\% & (10)+ 86.9\% & (19)+ 85.9\% & 88.6\% (135)* \\ \hline \end{tabular} \end{table}
PMC2716681_table_4
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|l|} \hline & \multicolumn{2}{c|}{\textbf{A2780}} & \multicolumn{2}{c|}{\textbf{A2780}/CDDP} & \multicolumn{2}{c|}{\textbf{SKOV3}} \\ \hline & \textbf{\textbf{\textbf{control}}} & \textbf{\textbf{\textbf{BRCA1 si}}} & \textbf{\textbf{\textbf{control}}} & \textbf{\textbf{\textbf{BRCA1 si}}} & \textbf{\textbf{\textbf{control}}} & \textbf{\textbf{\textbf{BRCA1 si}}} \\ \hline G1 & 52.57$\pm$5.11\% & 50.03$\pm$4.88\% & 48.87$\pm$4.76\% & 44.77$\pm$5.71\% & 45.07$\pm$4.1\% & 43.03$\pm$2.71\% \\ \hline S & 16.43$\pm$3.18\% & 19.33$\pm$2.81\% & 10.89$\pm$2.18\% & 10.40$\pm$3.23\% & 9.43$\pm$5.18\% & 9.39$\pm$1.86\% \\ \hline G2/M & 19.73$\pm$2.50\% & 21.37$\pm$2.76\% & 28.83$\pm$2.44\% & 29.39$\pm$3.50\% & 23.03$\pm$1.50\% & 23.99$\pm$2.90\% \\ \hline \end{tabular} \end{table}
PMC2716781_table_0
\begi\textbf{n}{table} \ce\textbf{n}teri\textbf{n}g \label{tab:tablelabel} \begi\textbf{n}{tabular}{|l|l|l|l|l|l|} \hli\textbf{n}e \textbf{Group} & \textbf{Site} & \textbf{n} & Wome\textbf{n}/Me\textbf{n} & \textbf{Age (years)} & \textbf{BMI (kg/m2)} \\ \hli\textbf{n}e \multirow{4}{*}{Co\textbf{n}trol} & UK & 21 & 20/1 & 40.5 $\pm$ 11.0 & 25.4 $\pm$ 3.8 \\ \hli\textbf{n}e Australia & 16 & 12/4 & 44.5 $\pm$ 12.1 & 24.3 $\pm$ 5.1 \\ \hli\textbf{n}e Spai\textbf{n} & 23 & 17/6 & 38.5 $\pm$ 11.1 & 23.0 $\pm$ 2.6 \\ \hli\textbf{n}e Total & 60 & 49/11 & 40.8 $\pm$ 11.4 & 24.2 $\pm$ 3.8 \\ \hli\textbf{n}e \multirow{4}{*}{Routes} & UK & 21 & 19/2 & 43.8 $\pm$ 10.2 & 25.2 $\pm$ 4.1 \\ \hli\textbf{n}e Australia & 19 & 13/6 & 43.3 $\pm$ 10.0 & 26.7 $\pm$ 4.4 \\ \hli\textbf{n}e Spai\textbf{n} & 20 & 13/7 & 39.4 $\pm$ 7.0 & 23.5 $\pm$ 2.8 \\ \hli\textbf{n}e Total & 60 & 45/15 & 42.1 $\pm$ 9.2 & 25.1 $\pm$ 4.0 \\ \hli\textbf{n}e \multirow{4}{*}{I\textbf{n}cide\textbf{n}tal} & UK & 21 & 18/3 & 39.8 $\pm$ 10.4 & 25.1 $\pm$ 3.4 \\ \hli\textbf{n}e Australia & 14 & 11/3 & 43.2 $\pm$ 10.3 & 28.1 $\pm$ 6.0 \\ \hli\textbf{n}e Spai\textbf{n} & 24 & 18/6 & 40.8 $\pm$ 8.9 & 24.0 $\pm$ 3.1 \\ \hli\textbf{n}e Total & 59 & 4712 & 41.0 $\pm$ 9.7 & 25.4 $\pm$ 4.3 \\ \hli\textbf{n}e \e\textbf{n}d{tabular} \e\textbf{n}d{table}
PMC2717045_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|l|} \hline & \multicolumn{5}{c|}{\textbf{Risk groups}} \\ \hline \textbf{Country} & \textbf{MSM} & \textbf{IDUs} & \textbf{Heterosexuals} & \textbf{Others} & \textbf{Unknown} & \textbf{Sum} \\ \hline United Kingdom (GBR) & 59 (66\%) & 0 (0\%) & 6 (7\%) & 0 (0\%) & 25 (28\%) & 90 \\ \hline Austria (AUT) & 18 (20\%) & 5(6\%) & 7 (8\%) & 0 (0\%) & 60 (67\%) & 90 \\ \hline Belgium (BEL) & 56 (65\%) & 3 (3\%) & 11 (13\%) & 4 (5\%) & 12 (14\%) & 86 \\ \hline Denmark (DNK) & 15 (17\%) & 4 (4\%) & 7 (8\%) & 0 (0\%) & 64 (71\%) & 90 \\ \hline Spain (ESP) & 46 (51\%) & 21 (23\%) & 17 (19\%) & 0 (0\%) & 6 (7\%) & 90 \\ \hline Germany (DEU) & 85 (94\%) & 0 (0\%) & (0\%) & 0 (0\%) & 5 (6\%) & 90 \\ \hline Greece (GRC) & 39 (53\%) & 3 (4\%) & 8 (11\%) & 1 (1\%) & 22 (30\%) & 73 \\ \hline Israel (ISR) & 15 (44\%) & 8 (24\%) & 7 (21\%) & 1 (3\%) & 3 (9\%) & 34 \\ \hline Italy (ITA) & 31 (34\%) & 15 (17\%) & 32 (36\%) & 0 (0\%) & 12 (13\%) & 90 \\ \hline Luxembourg (LUX) & 50 (56\%) & 15 (17\%) & 19 (21\%) & 0 (0\%) & 6 (7\%) & 90 \\ \hline Netherlands (NLD) & 57 (68\%) & 7 (8\%) & 15 (18\%) & 0 (0\%) & 5 (6\%) & 84 \\ \hline Norway (NOR) & 19 (73\%) & 1 (4\%) & 5 (19\%) & 0 (0\%) & 1 (4\%) & 26 \\ \hline Poland (POL) & 12 (13\%) & 42 (47\%) & 19 (21\%) & 0 (0\%) & 17 (19\%) & 90 \\ \hline Portugal (PRT) & 27 (30\%) & 16 (18\%) & 35 (39\%) & 0 (0\%) & 12 (13\%) & 90 \\ \hline Serbia & 22 (50\%) & 6 (14\% & 16 (36\%) & 0 (0\%) & 0 (0\%) & 44 \\ \hline Sweden (SWE) & 44 (49\%) & 3 (3\%) & 10 (11\%) & 0 (0\%) & 33 (37\%) & 90 \\ \hline Switzerland (CHE) & 48 (53\%) & 10 (11\%) & 28 (31\%) & 0 (0\%) & 4 (4\%) & 90 \\ \hline \textbf{Sum} & 643 (48\%) & 159 (12\%) & 242 (18\%) & 6 (0.5\%) & 287 (21\%) & 1337 \\ \hline \end{tabular} \end{table}
PMC2717046_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|} \hline & \textbf{White (291)} & \textbf{Hispanic (22)} & \textbf{Black (12)} & \textbf{Asian (5)} & \textbf{Other (15)} \\ \hline SNAP & 0.709 & 0.750 & 1.240 & 0.818 & 0.659 \\ \hline PAML & 0.839 & 0.826 & 1.411 & 1.346 & 0.751 \\ \hline HYPHY & 0.949 & 0.729 & 1.453 & 0.720 & 1.202 \\ \hline \end{tabular} \end{table}
PMC2717047_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|} \hline & \multicolumn{2}{c|}{\textbf{Race}} & \multicolumn{2}{c|}{\textbf{Race} by treatment} \\ \hline \textbf{Method} & \textbf{\textbf{ANOVA}} & \textbf{Corrected pairwise t-tests} & \textbf{\textbf{ANOVA}} & \textbf{lm coefficient} \\ \hline SNAP & (0.011) & black vs hispanic (0.020) black vs other (0.013) black vs white (0.004) & (0.025) & black placebo (0.001) \\ \hline PAML & (0.019) & black vs hispanic (0.047) black vs other (0.047) black vs white (0.033) & & black placebo (0.016) \\ \hline HYPHY & & & & black placebo (0.015) \\ \hline \end{tabular} \end{table}
PMC2717047_table_1
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|} \hline \textbf{Analyte} & \textbf{Collision energy (eV)} & \textbf{Collision exit potential (V)} & \textbf{Declustering potential (V)} & \textbf{Entrance potential (V)} \\ \hline myo-inositol & -10.0 & -5.0 & -70.0 & -10.0 \\ \hline [2H6]-myo-inositol & -18.0 & -9.0 & -70.0 & -10.0 \\ \hline \end{tabular} \end{table}
PMC2717050_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline \textbf{Time} & \textbf{Mean} & \textbf{SD} & \textbf{N} \\ \hline 1 & 6.33 & 4.1 & 45 \\ \hline 2 & 3.16 & 3.9 & 32 \\ \hline 3 & 0.88 & 2.47 & 17 \\ \hline \end{tabular} \end{table}
PMC2717051_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|l|l|l|l|} \hline & \multirow{2}{*}{\textbf{Time 1 Mean}} & \multirow{2}{*}{\textbf{\textbf{\textbf{SD}}}} & \multirow{2}{*}{\textbf{\textbf{\textbf{N}}}} & \multirow{2}{*}{\textbf{Time 2 Mean}} & \multirow{2}{*}{\textbf{\textbf{\textbf{SD}}}} & \multirow{2}{*}{\textbf{\textbf{\textbf{N}}}} & \multirow{2}{*}{\textbf{Time 3 Mean}} & \multirow{2}{*}{\textbf{\textbf{\textbf{SD}}}} & \multirow{2}{*}{\textbf{\textbf{\textbf{N}}}} \\ \hline \\ \hline Total Difficulties & 20.15 & 5.19 & 46 & 17.41 & 6.31 & 32 & 15.06 & 8.36 & 17 \\ \hline Pro-Social Behaviour & 6.09 & 2.3 & 46 & 6.38 & 2.67 & 32 & 6.2 & 3.22 & 17 \\ \hline Hyperactivity & 5.8 & 2.19 & 46 & 5.44 & 2.42 & 32 & 4.71 & 2.73 & 17 \\ \hline Conduct Problems & 4 & 2.07 & 46 & 3.69 & 2.15 & 32 & 2.76 & 2.44 & 17 \\ \hline Emotional Difficulties & 6.93 & 1.89 & 46 & 5.63 & 2.86 & 32 & 4.88 & 2.96 & 17 \\ \hline Peer Problems & 3.41 & 2.15 & 46 & 2.66 & 2.35 & 32 & 2.53 & 2.24 & 17 \\ \hline \end{tabular} \end{table}
PMC2717051_table_1
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline \textbf{Time} & \textbf{Mean} & \textbf{SD} & \textbf{N} \\ \hline 1 & 12.13 & 3.21 & 45 \\ \hline 2 & 13.48 & 3.48 & 31 \\ \hline 3 & 15 & 3.48 & 17 \\ \hline \end{tabular} \end{table}
PMC2717051_table_2
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|l|l|l|l|} \hline & \multirow{2}{*}{\textbf{Time 1 Mean}} & \multirow{2}{*}{\textbf{\textbf{\textbf{SD}}}} & \multirow{2}{*}{\textbf{\textbf{\textbf{N}}}} & \multirow{2}{*}{\textbf{Time 2 Mean}} & \multirow{2}{*}{\textbf{\textbf{\textbf{SD}}}} & \multirow{2}{*}{\textbf{\textbf{\textbf{N}}}} & \multirow{2}{*}{\textbf{Time 3 Mean}} & \multirow{2}{*}{\textbf{\textbf{\textbf{SD}}}} & \multirow{2}{*}{\textbf{\textbf{\textbf{N}}}} \\ \hline \\ \hline Challenges & 12.76 & 3.84 & 46 & 8.88 & 3.95 & 24 & 6.65 & 3.82 & 13 \\ \hline Goals & 6.14 & 2.93 & 46 & 10.66 & 4.18 & 22 & 11.35 & 4.65 & 13 \\ \hline \end{tabular} \end{table}
PMC2717051_table_3
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|} \hline \textbf{Parameters} & \textbf{Oromo folksongs} & \textbf{Remark} \\ \hline Lyrics & More than one issue is addressed & With the exception to some of the folksongs, most of them describe various and more than one issues \\ \hline Vocal style & Less ornamental to ornamental & Sometimes melismatic or strophic forms exist \\ \hline Timber & Soft to less harsh & Occasionally strident and forced singing \\ \hline Performer arrangement & Responsorial-leader chorus alternation is the dominant one & At times chorus-chorus alternation style. Responsorial- leader chorus alternation of male songs is less often followed by acclamation of women group. Few Solo songs exist. \\ \hline Melody & Have a narrow range up to a fifth interval; melodies are patterned in descending and ascending order; 2 or three melodies are used & The melodic form of the folksong is strophic consisting of two to eight lines. The relationships among the lines do vary or are similar. Some of the folksongs have similar or different content. Most of the folk songs are monophonic and some are polyphonic (more than one melodic line). Most of the songs listed here for describing the bioecocultural heritages are sung without accompaniment of instruments and hence are predominantly vocal folksongs. \\ \hline Scale & Major; natural minor; pentatonic major & Most of the folksongs collected here are diatonic or pentatonic or prepentatonic \\ \hline Rhythm & Hard to identify; not a major element; 3/4 or 6/8 & The rhythm and metre are not similar throughout the folksongs described. Mostly they are non-metric as they are mostly vocal. The music has been described as primarily melodic with simple rhythmic accompaniments that can be similar or different. \\ \hline Song type & Both secular and sacred & Folksongs are impulsive creations which are not developed by artists in organized ways hence can have various foci. \\ \hline Qñt* & Tzta and Bati & Most of the folksongs are composed without notations. It might be the same composer or different who created both the words and the music. One of the major classes of the folksongs, the ballads are narrative songs for describing varieties which are identified by their texts. The instrumental folksongs commonly accompanied by drums in the region are used for dances. \\ \hline \end{tabular} \end{table}
PMC2717052_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|} \hline \textbf{Patient characteristics} & \textbf{Number of patients} & \textbf{HER 2 +(\%)} \\ \hline Total Patients & 73 & 21 (28.8) \\ \hline Sex \\ \hline Male & 69 & 19 (27.5) \\ \hline Female & 4 & 2 (50) \\ \hline Stage \\ \hline Stage IIIB & 30 & 9 (30) \\ \hline Stage IV & 43 & 12 (27.9) \\ \hline Histopathology \\ \hline Adenocarcinoma & 27 & 11 (40.7) \\ \hline Squamous cell (Epidermoid) & 34 & 5 (14.7) \\ \hline Not otherwise specified (NOS) & 12 & 5 (41.6) \\ \hline \end{tabular} \end{table}
PMC2717055_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|} \hline \textbf{HER 2} & \textbf{CR+PR+SD} & \textbf{PD} \\ \hline \textbf{HER 2} (+) & 13 (63.9) & 8(38.1\%) \\ \hline \textbf{HER 2} (-) & 48 (92.3\%) & 4(7.7\%) \\ \hline \end{tabular} \end{table}
PMC2717055_table_1
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline \textbf{Patient characteristics} & \textbf{Number of patients} & \textbf{CR+PR+SD} & \textbf{PD} \\ \hline Total Patients & 73 & 61(83.6\%) & 12 (16.4\%) \\ \hline Sex \\ \hline Male & 69 & 58 (84\%) & 11 (16\%) \\ \hline Female & 4 & 3(75\%) & 1 (25\%) \\ \hline Stage \\ \hline Stage IIIB & 30 & 29(96.6\%) & 1(3.4\%) \\ \hline Stage IV & 43 & 32 (74.4\%) & 11 (25.6\%) \\ \hline Histopathology \\ \hline Adenocarcinoma & 27 & 21(78\%) & 6(22\%) \\ \hline Squamous cell (Epidermoid) & 34 & 31(91.2\%) & 3 (8.8\%) \\ \hline Not otherwise specified (NOS) & 12 & 9 (75\%) & 3 (25\%) \\ \hline \end{tabular} \end{table}
PMC2717055_table_2
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|l|l|} \hline \textbf{GO term} & \textbf{Level1} & \textbf{Genes2} & \textbf{ORFs3} & \textbf{Prot. DIP4} & \textbf{Prot.DIP/ ORFs (\%)} & \textbf{Prot. GOLD5} & \textbf{Prot.GOLD/ ORFs (\%)} \\ \hline Developmental process (BP) & 1 & 768 & 757 & 632 & 83.5\% & 257 & 34.0\% \\ \hline Reproduction (BP) & 1 & 299 & 298 & 245 & 82.2\% & 111 & 37.3\% \\ \hline Establishment of cellular localization (BP) & 1 & 573 & 568 & 452 & 79.6\% & 188 & 33.1\% \\ \hline Response to stimulus (BP) & 1 & 670 & 657 & 514 & 78.2\% & 207 & 31.5\% \\ \hline Ribonucleoprotein complex (CC) & 2 & 556 & 459 & 318 & 69.3\% & 96 & 20.9\% \\ \hline Organelle envelope (CC) & 2 & 346 & 345 & 230 & 66.7\% & 69 & 20.0\% \\ \hline Transcription regulator activity (MF) & 1 & 307 & 303 & 276 & 91.1\% & 107 & 35.3\% \\ \hline Structural molecule activity (MF) & 1 & 307 & 286 & 231 & 80.8\% & 75 & 26.2\% \\ \hline \multirow{2}{*}{Transporter activity (MF)} & 1 & 380 & 377 & 297 & 78.8\% & 63 & 16.7\% \\ \hline & & & & Average: 78.9\% & & Average: 28.3\% \\ \hline \end{tabular} \end{table}
PMC2717056_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|} \hline GO term & N (P) DIP & N (P) GOLD & GO term & N (P) DIP & N (P) GOLD \\ \hline Developmental process (32502) & 632 (16) & 257 (8) & Organelle envelope (31967) & 230 (12) & 69 (2) \\ \hline Reproductive developmental process (3006) & 26 (0) & 13 (0) & Organelle inner membrane (19866) & 105 (8) & 27 (2) \\ \hline Anatomical structure development (48856) & 186 (15) & 94 (8) & Organelle outer membrane (31968) & 24 (0) & --- \\ \hline Cellular developmental process (48869) & 450 (1) & 169 (0) & Organelle envelope lumen (31970) & 25 (0) & --- \\ \hline \multirow{2}{*}{Aging (7568)} & 40 (0) & 22 (0) & Nuclear envelope (5635) & 86 (3) & 35 (0) \\ \hline & & Mitochondrial envelope (5740) & 148 (9) & 34 (2) \\ \hline Reproduction (3) & 245 (7) & 111 (4) \\ \hline Sexual reproduction (19953) & 95 (0) & 41 (0) & Transcription regulator activity (30528) & 276 (14) & 107 (5) \\ \hline Asexual reproduction (19954) & 74 (6) & 44 (4) & Transcriptional activator activity (16563) & 50 (0) & 24 (0) \\ \hline Reproductive process (22414) & 207 (7) & 88 (4) & Transcriptional repressor activity (16564) & 35 (2) & 13 (1) \\ \hline \multirow{2}{*}{Rep. of a single-celled organism (32505)} & 220 (7) & 99 (4) & Transcription factor activity (3700) & 45 (2) & 13 (1) \\ \hline & & RNA polymerase II transcription factor activity (3702) & 112 (4) & 44 (1) \\ \hline Establishment of cellular localization (51649) & 452 (21) & 188 (10) & Transcriptional elongation regulator activity (3711) & 14 (6) & --- \\ \hline Secretion by cell (32940) & 206 (9) & 84 (3) & Transcription cofactor activity (3712) & 36 (1) & 16 (0) \\ \hline Establishment of nucleus localization (40023) & 17 (0) & --- \\ \hline \multirow{2}{*}{Intracellular transport (46907)} & 409 (21) & 175 (10) & Structural molecule activity (5198) & 231 (29) & 75 (18) \\ \hline & & Structural constituent of ribosome (3735) & 115 (0) & 21 (0) \\ \hline Response to stimulus (50896) & 514 (3) & 207 (0) & Structural constituent of cytoskeleton (5200) & 50 (29) & 31 (18) \\ \hline Response to endogenous stimulus (9719) & 197 (3) & 101 (0) \\ \hline Cellular response to stimulus (51716) & 13 (0) & --- & Transporter Activity (5215) & 297 (8) & 63 (1) \\ \hline Response to abiotic stimulus (9628) & 83 (0) & 32 (0) & Ion transport activity (15075) & 111 (5) & 16 (0) \\ \hline Response to external stimulus (9605) & 27 (0) & 13 (0) & Carbohydrate transporter activity (15144) & 26 (0) & --- \\ \hline Response to biotic stimulus (6907) & 19 (0) & --- & ATPase activity, coupled to movement of substances (43492) & 41 (2) & --- \\ \hline Response to chemical stimulus (42221) & 212 (0) & 65 (0) & Amine transporter activity (5275) & 27 (0) & --- \\ \hline \multirow{2}{*}{Response to stress (6950)} & 370 (3) & 159 (0) & Organic acid transporter activity (5342) & 32 (0) & --- \\ \hline & & Carrier activity (5386) & 67 (0) & 13 (0) \\ \hline Ribonucleoprotein complex (30529) & 318 (64) & 96 (12) & Intracellular transporter activity (5478) & 28 (0) & 17 (0) \\ \hline Small nuclear ribonucleoprotein complex (30532) & 58 (2) & 24 (0) & Protein transporter activity (8565) & 48 (1) & 29 (1) \\ \hline Preribosome (30684) & 12 (4) & --- & Lipid transporter activity (5319) & 11(2) & --- \\ \hline Spliceosome (5681) & 74 (12) & 33 (2) \\ \hline Small nucleolar ribonucleoprotein complex (5732) & 49 (43) & 10 (9) \\ \hline Ribosome (5840) & 156 (5) & 45 (1) \\ \hline Polysome (5844) & 11 (0) & --- \\ \hline \end{tabular} \end{table}
PMC2717056_table_1
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|} \hline \textbf{GO TERMS} & \textbf{Coverage} & \textbf{Purity (Average)} & \textbf{Ambiguity} & \textbf{Φ(average $\pm$ s.e.m.)} \\ \hline Developmental process (32502) & 63.6\% (402/632) & 62.2\% & 13.0\% (74/570) & 0.46 $\pm$ 0.02 \\ \hline Reproduction (3) & 58.4\% (142/245) & 94.1\% & 0\% (0/25) & 0.38 $\pm$ 0.11 \\ \hline Establishment of cellular localization (51649) & 66.8\% (302/452) & 88.4\% & 1.1\% (3/264) & 0.43 $\pm$ 0.10 \\ \hline Response to stimulus (50896) & 56.4\% (290/514) & 77.5\% & 19.5\% (32/164) & 0.46 $\pm$ 0.05 \\ \hline Ribonucleoprotein complex (30529) & 59.7\% (190/318) & 77.8\% & 12.8\% (31/242) & 0.64 $\pm$ 0.06 \\ \hline Organelle envelope (31967) & 39.6\% (91/230) & 84.9\% & 1.2\% (1/83) & 0.47 $\pm$ 0.09 \\ \hline Transcription regulator activity (30528) & 43.5\% (120/276) & 67.6\% & 15.0\% (30/200) & 0.40 $\pm$ 0.08 \\ \hline Structural molecule activity (5198) & 39.8\% (92/231) & 95.6\% & 0\% (0/165) & 0.53 \\ \hline Transporter Activity (5215) & 33.7\% (100/297) & 72.5\% & 6.4\% (12/186) & 0.43 $\pm$ 0.06 \\ \hline \end{tabular} \end{table}
PMC2717056_table_2
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|} \hline \textbf{GO TERMS} & \textbf{Coverage} & \textbf{Purity (Average)} & \textbf{Ambiguity} & \textbf{Φ(average $\pm$ s.e.m.)} \\ \hline Developmental process (32502) & 83.3\% (214/257) & 82.0\% & 7.2\% (16/222) & 0.51 $\pm$ 0.06 \\ \hline Reproduction (3) & 96.4\% (107/111) & 82.5\% & 8.3\% (1/12) & 0.45 $\pm$ 0.03 \\ \hline Establishment of cellular localization (51649) & 86.7\% (163/188) & 76.8\% & 46.2\% (49/106) & 0.37 $\pm$ 0.02 \\ \hline Response to stimulus (50896) & 78.3\% (162/207) & 73.2\% & 32.1\% (18/56) & 0.48 $\pm$ 0.07 \\ \hline Ribonucleoprotein complex (30529) & 82.3\% (79/96) & 70.7\% & 56.2\% (41/73) & 0.72 $\pm$ 0.03 \\ \hline Organelle envelope (31967) & 87.0\% (60/69) & 79.5\% & 26.5\% (9/34) & 0.70 $\pm$ 0.05 \\ \hline Transcription regulator activity (30528) & 39.3\% (42/107) & 64.7\% & 33.8\% (26/77) & 0.42 $\pm$ 0.03 \\ \hline Structural molecule activity (5198) & 69.3\% (52/75) & 68.8\% & 42.3\% (22/52) & 0.91 \\ \hline Transporter Activity (5215) & 87.3\% (55/63) & 93.6\% & 0.0\% (0/50) & 0.63 $\pm$ 0.13 \\ \hline \end{tabular} \end{table}
PMC2717056_table_3
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|l|l|} \hline & \textbf{A priori Genetic Group} & \textbf{Geneclass} & & & \textbf{Structure} \\ \hline & & RFLP & SSR & RFLP & & SSR \\ \hline Individuals & & & & Ancestry (\%) & CI & Ancestry (\%) & CI \\ \hline AC663 & A & E 1.445 & & E 43.5 A 39 B 14.2 & 0–100 0–100 0–61 \\ \hline CC604 & C & - & E 3.224 & & - & E 49.1 C 47.4 & 23.3–76.2 18.4–73.5 \\ \hline CC658 & C & - & D 5.010 & & - & D 56.3 A 21.2 & 24.8–83.6 0–71.9 \\ \hline DC186 & D & - & - & D 64 E 16 A 16 & 36.1–86.5 0–52.8 0–54.2 & D 57.9 A 33.5 & 29.6–84 0–68.3 \\ \hline DC194 & D & - & - & D 37.5 E 29.6 A 31.6 & 0–66.1 0–85.8 0–94.2 & D 72.6 E 25.3 & 48.3–94.4 0–50.3 \\ \hline DC345 & D & A 0.579 & E 0.526 & D 33.7 E 30 A 34.3 & 0–65.2 0–97.3 0–997 & D 51.5 E 38.7 & 26.7–74.7 12.9–65.2 \\ \hline DC350 & D & - & E 1.553 & D 54.5 E 20.7 A 21.7 & 0–87.1 0–75.5 0–91.7 & D 42.4 E 51.6 & 19.8–65.5 14.2–76.9 \\ \hline DC358 & D & - & - & D 49.9 E 21 A 21.5 & 12.1–77.9 0–66.6 0–68.5 & D 64.3 E 21.2 & 42.6–83.7 0–51.2 \\ \hline \end{tabular} \end{table}
PMC2717059_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|} \hline \textbf{SSR\RFLP} & \textbf{A} & \textbf{B} & \textbf{C} & \textbf{D} & \textbf{E} \\ \hline \textbf{A} & 0 & 0.29 & 0.50 & 0.67 & 0.30 \\ \hline \textbf{B} & 0.33 & 0 & 0.51 & 0.67 & 0.30 \\ \hline \textbf{C} & 0.30 & 0.24 & 0 & 0.54 & 0.41 \\ \hline \textbf{D} & 0.50 & 0.45 & 0.32 & 0 & 0.52 \\ \hline \textbf{E} & 0.31 & 0.20 & 0.25 & 0.34 & 0 \\ \hline \end{tabular} \end{table}
PMC2717059_table_1
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|} \hline \textbf{Variable, \% unless otherwise indicated} & \textbf{EuroSCORE > 20, n = 237} & \textbf{EuroSCORE $\leq$ 20, n = 1,184} \\ \hline Critical preoperative state* & 24.5 & 1.0 \\ \hline Emergency surgery & 10.1 & 0.9 \\ \hline Concomitant thoracic aortic surgery & 16.5 & 5.7 \\ \hline Concomitant CABG & 58.7 & 42.2 \\ \hline Type of prosthesis \\ \hline Bioprosthesis (tissue valve) Mechanical valve Homograft & 84.0 13.5 2.5 & 81.7 17.6 0.8 \\ \hline Cardiopulmonary bypass time, mean min $\pm$ SD & 178.5 $\pm$ 64.4 & 148.8 $\pm$ 51.8 \\ \hline Aortic clamp time, mean min $\pm$ SD & 122.8 $\pm$ 47.0 & 106.7 $\pm$ 37.8 \\ \hline Prosthetic valve indexed EOA§<0.75 cm2/m2 & 4.7 & 10.4 \\ \hline \end{tabular} \end{table}
PMC2717063_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline \textbf{Outcome, \%} & \textbf{EuroSCORE > 20, n = 237} & \textbf{$\leq$ EuroSCORE 20, n = 1,184} & \textbf{P} \\ \hline Mortality (in-hospital or within 30 days of surgery) & 11.4 & 3.2 & <0.0001 \\ \hline In-hospital events \\ \hline Ventilation > 24 hours & 27.9 & 9.3 & <0.0001 \\ \hline Length of stay > 9 days & 59.1 & 28.1 & <0.0001 \\ \hline Stroke & 5.1 & 2.3 & 0.02 \\ \hline Atrial fibrillation (new onset) & 31.7 & 28.4 & 0.31 \\ \hline Erythrocyte transfusion & 73.0 & 34.5 & <0.0001 \\ \hline \textbf{P}ermanent pacemaker implantation & 10.1 & 5.4 & 0.01 \\ \hline \end{tabular} \end{table}
PMC2717063_table_1
\begi\textbf{n}{table} \ce\textbf{n}teri\textbf{n}g \label{tab:tablelabel} \begi\textbf{n}{tabular}{|l|l|l|l|l|l|l|l|l|} \hli\textbf{n}e \textbf{WHO} & \textbf{n} & \textbf{Age (yr)} & \textbf{MGb(\%)} & \textbf{Weight (g)} & \textbf{Masaoka I} & \textbf{Masaoka I}I & \textbf{Masaoka I}II & \textbf{Masaoka I}V \\ \hli\textbf{n}e A & 15 & 64.0 $\pm$ 9.8 & 26.6 & 164.0 $\pm$ 293.0 & 10 & 4 & 1 & 0 \\ \hli\textbf{n}e AB & 21 & 58.5 $\pm$ 10.6 & 14.2 & 114.0 $\pm$ 131.4 & 15 & 2 & 4 & 0 \\ \hli\textbf{n}e B1 & 13 & 58.6 $\pm$ 6.3 & 23.0 & 103.0 $\pm$ 99.5 & 9 & 2 & 1 & 1 \\ \hli\textbf{n}e B2 & 13 & 51.8 $\pm$ 20.3 & 53.0 & 125.0 $\pm$ 108.6 & 5 & 6 & 0 & 2 \\ \hli\textbf{n}e B3 & 3 & 67.8 $\pm$ 23.4 & 66.6 & 166.0 $\pm$ 83.5 & 1 & 2 & 0 & 0 \\ \hli\textbf{n}e C & 19 & 54.1 $\pm$ 13.4 & 0 & 139.0 $\pm$ 403.4 & 2 & 3 & 3 & 11 \\ \hli\textbf{n}e Total & 84 & - & 22.6 & - & 42 & 19 & 9 & 14 \\ \hli\textbf{n}e \e\textbf{n}d{tabular} \e\textbf{n}d{table}
PMC2717064_table_0
\begi\textbf{n}{table} \ce\textbf{n}teri\textbf{n}g \label{tab:tablelabel} \begi\textbf{n}{tabular}{|l|l|l|l|l|l|l|} \hli\textbf{n}e \textbf{Masaoka} & \textbf{n} & \textbf{R0-status} & \textbf{N1} & \textbf{M1} & Recurre\textbf{n}ce & \textbf{5-year survival (\%)} \\ \hli\textbf{n}e I & 42 & 42 (100\%) & 0 (0\%) & 0 (0\%) & 0 (0\%) & 97.6 \\ \hli\textbf{n}e II & 19 & 18 (94.7\%) & 0 (0\%) & 0 (0\%) & 1 (5.3\%) & 94.7 \\ \hli\textbf{n}e III & 9 & 6 (66.7\%) & 0 (0\%) & 0 (0\%) & 0 (0\%) & 66.7 \\ \hli\textbf{n}e IV & 14 & 5 (35.7\%) & 6 (42.8\%) & 8 (57.1) & 1 (7\%) & 64.3 \\ \hli\textbf{n}e \e\textbf{n}d{tabular} \e\textbf{n}d{table}
PMC2717064_table_1
\begi\textbf{n}{table} \ce\textbf{n}teri\textbf{n}g \label{tab:tablelabel} \begi\textbf{n}{tabular}{|l|l|l|l|l|l|} \hli\textbf{n}e \textbf{Characteristics} & \textbf{n} & \textbf{Pseudocapsula complete} & Pseudocapsula i\textbf{n}complete & Pseudocapsula \textbf{n}o capsula & \textbf{p-valueb} \\ \hli\textbf{n}e Masaoka I & 42 & 38 & 4 & 0 & 0.001 \\ \hli\textbf{n}e II & 19 & 1 & 16 & 2 \\ \hli\textbf{n}e III & 9 & 1 & 3 & 5 \\ \hli\textbf{n}e IV & 14 & 0 & 3 & 11 \\ \hli\textbf{n}e N-status N0 & 79 & 40 & 24 & 15 & 0.042 \\ \hli\textbf{n}e N1 & 5 & 0 & 2 & 3 \\ \hli\textbf{n}e M-status M0 & 76 & 40 & 25 & 11 & 0.001 \\ \hli\textbf{n}e M1 & 8 & & 1 & 7 \\ \hli\textbf{n}e Vessel i\textbf{n}filtratio\textbf{n} & 13 & 0 & 3 & 9 & 0.001 \\ \hli\textbf{n}e Pericard i\textbf{n}filtratio\textbf{n} & 14 & 1 & 1 & 12 & 0.001 \\ \hli\textbf{n}e Recurre\textbf{n}ce & 2 & 0 & 1 & 1 & 0.047 \\ \hli\textbf{n}e Age (yr)c & 84 & 40 & 26 & 18 & 0.44 \\ \hli\textbf{n}e Sex Male & 45 & 14 & 17 & 14 & 0.004 \\ \hli\textbf{n}e Female & 39 & 26 & 9 & 4 \\ \hli\textbf{n}e MGd & 19 & 10 & 6 & 3 & 0.86 \\ \hli\textbf{n}e \e\textbf{n}d{tabular} \e\textbf{n}d{table}
PMC2717064_table_2
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|} \hline \textbf{Risk factor} & \textbf{Univariate analysis} & \multicolumn{3}{c|}{\textbf{Multivariate analysisc}} \\ \hline & \textbf{\textbf{p value}b} & \textbf{Relative risk} & \textbf{95\% Confidence interval} & \textbf{p value} \\ \hline R-status & 0.0001 & 3.9 & 2.0 – 7.6 & 0.001 \\ \hline Masaoka stagingd & 0.0001 & 2.0 & 1.0 – 4.1 & 0.020 \\ \hline Presence of a pseudocapsula & 0.0002 & - & - & 0.179 \\ \hline WHOd classificatione & 0.0001 & - & - & 0.181 \\ \hline Sex & 0.562 & - & - & 0.849 \\ \hline Age & 0.360 & - & - & 0.206 \\ \hline \end{tabular} \end{table}
PMC2717064_table_3
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline \textbf{Examination subject} & \textbf{Date} & \textbf{Format} & \textbf{Reliability (KR20)} \\ \hline \multirow{2}{*}{Generic clinical knowledge} & March & EMQ & 0.758 \\ \hline August & EMQ & 0.730 \\ \hline Care of the Elderly and & March & SBA & 0.760 \\ \hline General Medical Specialties & August & SBA & 0.757 \\ \hline \multirow{2}{*}{General Medicine, Medicine in the Community and Surgery} & March & SBA & 0.760 \\ \hline August & SBA & 0.705 \\ \hline \end{tabular} \end{table}
PMC2717066_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|} \hline & \textbf{Intervention group n = (\%)} & \textbf{Control group n = (\%)} & \textbf{Total n = (\%)} & \textbf{Group differences} & \textbf{p value} \\ \hline & \multicolumn{2}{c|}{\textbf{Total n = (\%)}Tutor} \\ \hline Total & 6 & 6 & 12 & n/a & n/a \\ \hline male & 1 (16.7) & 2 (33.3) & 3 (25.0) & n/a & n/a \\ \hline white & 6 (100.0) & 5 (83.3) & 11 (91.7) & n/a & n/a \\ \hline & \multicolumn{2}{c|}{Student factors} \\ \hline Total & 177/348 (50.9) & 171/348 (49.1) & 348 (100.0) \\ \hline Mean age & 22 yrs 4 months & 22 yrs 4 months & 22 yrs 4 months & t(346) = 0.8 & 0.94 \\ \hline white* & 80/175 (45.7) & 87/166 (52.5) & 167/341 (49.0) & χ2 = 1.9; df = 3 & 0.60 \\ \hline Asian Indian, Pakistani, Bangladeshi & 47/175 (26.9) & 37/166 (22.3) & 84/341 (34.0) & χ2 = 1.9; df = 3 & 0.60 \\ \hline Chinese & 16/175 (9.1) & 12/166 (7.2) & 28/341 (8.2) & χ2 = 1.9; df = 3 & 0.60 \\ \hline All Other & 32/175 (18.3) & 30/166 (18.1) & 62/341 (18.2) & χ2 = 1.9; df = 3 & 0.60 \\ \hline Male** & 69/176 (39.2) & 59/171 (34.5) & 128/347 (36.9) & χ2 = 0.8; df = 1 & 0.36 \\ \hline Graduate entry*** & 23/176 (13.1) & 20/166 (12.1) & 43/342 (12.6) & χ2 = 0.1; df = 1 & 0.75 \\ \hline With iBSC*** & 107/176 (60.8) & 101/166 (60.8) & 208/342 (60.8) & χ2 = 0.2; df = 1 & 0.89 \\ \hline Oxford or Cambridge transfer & 21/177 (11.9) & 30/171 (17.5) & 51/348 (14.7) & χ2 = 2.2; df = 1 & 0.13 \\ \hline Mean pre-intervention written z score & 0.05 (SD = 1.0) & -0.05 (SD = 1.0) & 0.00 (SD = 1.0) & t(343) = -0.9 & 0.36 \\ \hline Mean Neuroticism score & 8.1 (SD = 2.3) & 7.8 (SD = 2.3) & 8.0 (SD = 2.3) & t(270) = -0.8 & 0.45 \\ \hline Mean Conscientiousness score & 11.3 (SD = 2.6) & 11.3 (SD = 2.0) & 11.3 (SD = 2.3) & t(272) = 0.2 & 0.86 \\ \hline Mean Openness score & 11.1 (SD = 2.2) & 10.9 (SD = 2.4) & 11.0 (SD = 2.3) & t(272) = -0.9 & 0.39 \\ \hline Mean Agreeableness score & 13.3 (SD = 1.6) & 13.0 (SD = 1.6) & 13.2 (SD = 1.6) & t(268) = -1.8 & 0.07 \\ \hline Mean Extraversion score & 11.6 (SD = 2.1) & 11.6 (SD = 1.8) & 11.6 (SD = 1.9) & t(271) = -0.13 & 0.90 \\ \hline Mean Surface study score & 14.9 (SD = 3.9) & 14.7 (SD = 3.4) & 14.8 (SD = 3.6) & t(265) = -0.5 & 0.61 \\ \hline Mean Strategic study score & 18.5 (SD = 5.4) & 17.7 (SD = 4.7) & 18.1 (SD = 5.1) & t(266) = -0.8 & 0.45 \\ \hline Mean Deep study score & 19.4 (SD = 4.1) & 19.3 (SD = 3.9) & 19.3 (SD = 4.0) & t(267) = -0.3 & 0.79 \\ \hline Mean GHQ (stress) score & 11.4 (SD = 5.3) & 10.2 (SD = 4.4) & 10.8 (SD = 4.9) & t(262) = -1.9 & 0.06 \\ \hline \end{tabular} \end{table}
PMC2717066_table_1
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|} \hline \textbf{Ethnic group} & \textbf{Condition} & \textbf{Mean written z-score (SD)} & \textbf{Mean OSCE z-score (SD)} & \textbf{N} \\ \hline \multirow{2}{*}{W} & Intervention & 0.063 (0.90) & 0.271 (0.96) & 79 \\ \hline Control & 0.244 (1.00) & -0.002 (0.96) & 84 \\ \hline \multirow{2}{*}{EM} & Intervention & -0.098 (1.09) & 0.001 (1.00) & 95 \\ \hline Control & -0.175 (0.96) & -0.286 (0.97) & 77 \\ \hline \end{tabular} \end{table}
PMC2717066_table_2
\begin{\textbf{t}able} \cen\textbf{t}ering \label{\textbf{t}ab:\textbf{t}ablelabel} \begin{\textbf{t}abular}{|l|l|l|l|l|l|l|l|} \hline \\textbf{t}ex\textbf{t}bf{Dimensions} & \\textbf{t}ex\textbf{t}bf{Word ca\textbf{t}egories} & \\textbf{t}ex\textbf{t}bf{Type of word} & \\textbf{t}ex\textbf{t}bf{Group wi\textbf{t}h highes\textbf{t} frequency} & \textbf{t} & Mean use by all s\textbf{t}uden\textbf{t}s & Mean Difference be\textbf{t}ween groups & \textbf{p value} \\ \hline \mul\textbf{t}irow{2}{*}{S\textbf{t}andard linguis\textbf{t}ic dimensions} & \% of dic\textbf{t}ionary words & & EM & -2.0 & 75.5 & -1.2 & 0.04 \\ \hline To\textbf{t}al pronouns & Pronoun & EM & -2.8 & 10.9 & -0.9 & 0.01 \\ \hline \mul\textbf{t}irow{4}{*}{Psychologi-cal processes} & Affec\textbf{t}ive or emo\textbf{t}ional processes & Op\textbf{t}imism and energy (cer\textbf{t}ain\textbf{t}y, pride, win) & W & 2.0 & 0.9 & 0.2 & 0.05 \\ \hline Cogni\textbf{t}ive processes & Cogni\textbf{t}ive processes & EM & -2.2 & 0.1 & -0.5 & 0.03 \\ \hline Sensory and percep\textbf{t}ual processes & Hear (heard, lis\textbf{t}en, sound) & EM & -3.5 & 0.9 & -0.3 & <0.001 \\ \hline Social Processes & Communica\textbf{t}ion (\textbf{t}alk, share converse) & EM & -2.4 & 2.2 & -0.4 & 0.02 \\ \hline Rela\textbf{t}ivi\textbf{t}y & Mo\textbf{t}ion & Mo\textbf{t}ion (walk, move, go) & EM & -2.5 & 0.9 & -0.2 & 0.01 \\ \hline \mul\textbf{t}irow{2}{*}{Personal Concerns} & Occupa\textbf{t}ion & Job or work (employ, boss, career) & W & 2.2 & 1.1 & 0.2 & 0.03 \\ \hline Me\textbf{t}aphysical issues & Religion (God, church, rabbi) & EM & -2.1 & 0.2 & -0.2 & 0.04 \\ \hline \end{\textbf{t}abular} \end{\textbf{t}able}
PMC2717066_table_3
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|} \hline \textbf{Characteristics} & \textbf{Study aggregate} \\ \hline Age (year), Median (IQR*) & 35 (33–37) \\ \hline Gender (W:M) & 43\%/57\% \\ \hline Married & 65\% \\ \hline Time from medical school to residency training (years), Median (IQR*) & 5 (4–7) \\ \hline Visa status (J1/H1/Employment authorization) & 88\% \\ \hline Asian origin & 59\% \\ \hline USMLE Step 1, Median (IQR*) & 85 (80–88) \\ \hline USMLE Step 2 Clinical skills, Median (IQR*) & 82 (79–87) \\ \hline Pre-GME Clinical experience, n (\%) & 43/51 (84) \\ \hline Pre-GME Research Experience, n (\%) & 34/51 (66.7) \\ \hline US Externship, n (\%) & 14/51 (27.5) \\ \hline Pre-GME Awards, n (\%) & 26/51(50.1) \\ \hline ABIM examination pass, n (\%) & 49/51(96) \\ \hline Fellowship aspirants, n (\%) & 12/51 (23.5) \\ \hline Fellowship within 3 years after graduation, n (\%) & 8/51 (16) \\ \hline \end{tabular} \end{table}
PMC2717068_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline \textbf{Characteristics} & \textbf{Above PG level median (n = 18)} & \textbf{Below PG level median (n = 33)} & \textbf{*P value} \\ \hline Age, median (range) in years & 33 (31–40) & 36 (31–47) & < 0.05 \\ \hline Male:Female (ratio) & 9:9 & 20:13 & NS \\ \hline Marital Status (unmarried: married) & 5:13 & 13:20 & NS \\ \hline Asian/Others & 3/5 & 16/17 & NS \\ \hline #USMLE step I median (range) & 86 (76–97) & 83 (75–96) & NS \\ \hline USMLE step II Clinical skills median (range) & 86 (77–93) & 80 (75–92) & < 0.05 \\ \hline Time from medical school to residency, median (range) in years & 4 (1 – 14) & 5 (1–17) & NS \\ \hline Temporary Visa status (n) & 16 & 29 & NS \\ \hline Pre-GME Clinical Experience (n) & 15 & 28 & NS \\ \hline Pre-GME Research Experience (n) & 12 & 22 & NS \\ \hline US Externship & 7 & 7 & NS \\ \hline Pre-GME Awards & 9 & 17 & NS \\ \hline \end{tabular} \end{table}
PMC2717068_table_1
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline \textbf{Characteristics} & \textbf{Above US Median (n = 13)} & \textbf{Below US Median (n = 38)} & \textbf{*P value} \\ \hline Age, median (range) in years & 35 (32–42) & 35.5 (31–47) & NS \\ \hline **Male/Female (ratio) & 11:2 & 18: 20 & < 0.05 \\ \hline Marital Status (unmarried/married) & 8: 5 & 25: 13 & NS \\ \hline Asian/Others & 9/4 & 21/17 & NS \\ \hline #USMLE step I median (range) & 86 (76–97) & 83 (75–96) & < 0.05 \\ \hline USMLE step II Clinical Skills median (range) & 86 (77–93) & 80 (75–92) & < 0.05 \\ \hline Time from medical school to residency, median (range) in years & 4 (1 – 14) & 5 (1–17) & NS \\ \hline Temporary Visa status (n) & 11 & 34 & NS \\ \hline Pre-GME Clinical Experience (n) & 15 & 28 & NS \\ \hline Pre-GME Research Experience (n) & 12 & 22 & NS \\ \hline US Externship & 7 & 7 & NS \\ \hline Pre-GME Awards & 9 & 17 & NS \\ \hline \end{tabular} \end{table}
PMC2717068_table_2
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline \textbf{#Characteristics} & \textbf{Above US Median} & \textbf{Below US Median} & \textbf{P value} \\ \hline \multicolumn{2}{c|}{(Above median} \\ \hline Male/Female (ratio) (unadjusted analysis) & 22:10 & 7: 12 & < 0.05 \\ \hline #USMLE step I median (range) & 85 (77–97) & 82 (75–96) & NS \\ \hline USMLE step II Clinical skills median (range) & 85.5 (75–93) & 81 (76–87) & NS \\ \hline \multicolumn{2}{c|}{(Above median} \\ \hline Male/Female (ratio) (unadjusted analysis) & 11: 3 & 18: 19 & NS \\ \hline #USMLE step I median (range) & 86.5 (76–97) & 82.5 (75–90) & < 0.05 \\ \hline USMLE step II Clinical skills median (range) & 85.5 (75–93) & 81 (76–87) & < 0.05 \\ \hline \end{tabular} \end{table}
PMC2717068_table_3
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline \textbf{Characteristics (units)} & \textbf{Fellowship pursuing residents (n = 8)} & \textbf{Others (n = 43)} & \textbf{P value} \\ \hline Age, median (range) in years & 33 (31 – 39) & 35 (31–47) & NS \\ \hline Male/Female (ratio) & 4:4 & 25: 18 & NS \\ \hline Marital status (unmarried/married) & 6: 2 & 27:16 & NS \\ \hline Asian/Others & 4/4 & 26/17 & NS \\ \hline #USMLE step I median (range) & 85 (76–97) & 85 (75–96) & NS \\ \hline USMLE step II Clinical skills median (range) & 82.5 (80–92) & 82 (75–93) & NS \\ \hline Time from medical school to residency, median (range) in years & 5 (3 – 14) & 5 (1–17) & NS \\ \hline Visa status & 7 & 38 & NS \\ \hline Pre-GME Clinical Experience (n) & 7 & 36 & NS \\ \hline Pre-GME Research Experience (n) & 5 & 29 & NS \\ \hline US Externship (n) & 1 & 13 & NS \\ \hline Pre-GME Awards (n) & 5 & 21 & NS \\ \hline Fellowship aspirants (n) & 7 & 5 & < 0.05 \\ \hline GME Research (n) & 7 & 12 & < 0.05 \\ \hline \end{tabular} \end{table}
PMC2717068_table_4
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|l|l|} \hline \textbf{Question} & \multicolumn{7}{c|}{\textbf{Likert Scale}} \\ \hline \textbf{How valuable has the student housing conditions survey, and discussion of findings, been for you?} & \textbf{Extremely valuable} & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & \textbf{Not at all valuable} \\ \hline & No. & \textbf{2}9 & 60 & \textbf{3}\textbf{2} & \textbf{1}\textbf{2} & \textbf{3} \\ \hline & \% & \textbf{2}\textbf{1}\% & \textbf{4}\textbf{4}\% & \textbf{2}\textbf{4}\% & 9\% & \textbf{2}\% \\ \hline \multirow{\textbf{3}}{*}{Did this survey and seminar discussion improve your understanding of research methods?} & Yes, greatly & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & No, not at all \\ \hline No. & \textbf{1}8 & \textbf{5}\textbf{2} & \textbf{4}7 & \textbf{1}\textbf{3} & 6 \\ \hline \% & \textbf{1}\textbf{3}\% & \textbf{3}8\% & \textbf{3}\textbf{5}\% & \textbf{1}0\% & \textbf{4}\% \\ \hline \multirow{\textbf{3}}{*}{Did this survey and seminar discussion improve your understanding of epidemiology?} & Yes, greatly & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & No, not at all \\ \hline No. & \textbf{1}6 & \textbf{4}\textbf{1} & \textbf{5}\textbf{2} & \textbf{2}0 & 7 \\ \hline \% & \textbf{1}\textbf{2}\% & \textbf{3}0\% & \textbf{3}8\% & \textbf{1}\textbf{5}\% & \textbf{5}\% \\ \hline \multirow{\textbf{3}}{*}{Did this survey and seminar discussion improve your understanding of the environmental determinants of health?} & Yes, greatly & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & No, not at all \\ \hline No. & \textbf{2}8 & 69 & \textbf{3}0 & 7 & \textbf{2} \\ \hline \% & \textbf{2}\textbf{1}\% & \textbf{5}\textbf{1}\% & \textbf{2}\textbf{2}\% & \textbf{5}\% & \textbf{1}\% \\ \hline \multirow{\textbf{3}}{*}{Did this survey and seminar discussion improve your interest in public health?} & Yes, greatly & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & No, not at all \\ \hline No. & \textbf{2}\textbf{3} & \textbf{5}8 & \textbf{3}\textbf{4} & \textbf{1}\textbf{2} & 9 \\ \hline \% & \textbf{1}7\% & \textbf{4}\textbf{3}\% & \textbf{2}\textbf{5}\% & 9\% & 7\% \\ \hline \multirow{\textbf{3}}{*}{Did this survey and seminar discussion improve your interest in health research?} & Yes, greatly & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & No, not at all \\ \hline No. & \textbf{1}6 & \textbf{4}8 & \textbf{4}6 & \textbf{1}\textbf{5} & \textbf{1}\textbf{1} \\ \hline \% & \textbf{1}\textbf{2}\% & \textbf{3}\textbf{5}\% & \textbf{3}\textbf{4}\% & \textbf{1}\textbf{1}\% & 8\% \\ \hline \multirow{\textbf{3}}{*}{Did this survey stimulate you to discuss housing and health issues with friends outside of class?} & Yes, often & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & No, never \\ \hline No. & \textbf{3}0 & \textbf{4}\textbf{5} & \textbf{4}\textbf{3} & \textbf{1}\textbf{3} & \textbf{5} \\ \hline \% & \textbf{2}\textbf{2}\% & \textbf{3}\textbf{3}\% & \textbf{3}\textbf{2}\% & \textbf{1}0\% & \textbf{4}\% \\ \hline \multirow{\textbf{3}}{*}{How much did this survey and seminar discussion challenge you to think?} & A great deal & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & Very Little \\ \hline No. & \textbf{2}\textbf{1} & 6\textbf{3} & \textbf{3}\textbf{5} & \textbf{1}\textbf{1} & \textbf{5} \\ \hline \% & \textbf{1}\textbf{5}\% & \textbf{4}6\% & \textbf{2}6\% & 8\% & \textbf{4}\% \\ \hline \multirow{\textbf{3}}{*}{Has this survey and seminar discussion made you more aware and concerned about societal problems?} & Yes, greatly & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & No, not at all \\ \hline No. & \textbf{3}8 & \textbf{5}7 & \textbf{3}\textbf{2} & \textbf{4} & \textbf{4} \\ \hline \% & \textbf{2}8\% & \textbf{4}\textbf{2}\% & \textbf{2}\textbf{4}\% & \textbf{3}\% & \textbf{3}\% \\ \hline \multirow{\textbf{3}}{*}{Would you support use of this survey and seminar discussion for future \textbf{3}rd year classes?} & Yes, greatly & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & No, not at all \\ \hline No. & \textbf{5}6 & \textbf{4}9 & \textbf{2}\textbf{3} & 6 & \textbf{2} \\ \hline \% & \textbf{4}\textbf{1}\% & \textbf{3}6\% & \textbf{1}7\% & \textbf{4}\% & \textbf{1}\% \\ \hline \end{tabular} \end{table}
PMC2717069_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline & \multicolumn{2}{c|}{\textbf{Groups}} \\ \hline & \textbf{Hypoglycemic (n = 436)} & \textbf{Controls (n = 434)} & \textbf{P-value} \\ \hline Cervical ripening & 36 (8\%) & 38 (9\%) & 0.792 \\ \hline Induction of labor & 129 (30\%) & 87 (20\%) & <0.001 \\ \hline Delivery mode \\ \hline Spontaneous vaginal & 314 (72\%) & 295 (68\%) \\ \hline Assisted vaginal & 15 (3\%) & 14 (3\%) \\ \hline Cesarean section & 107 (25\%) & 125 (29\%) & 0.364 \\ \hline Reason for cesarean section(1) \\ \hline Fetal distress & 26 (24\%) & 23 (18\%) \\ \hline Failure to progress & 24 (22\%) & 36 (29\%) \\ \hline Repeat cesarean section & 35 (32\%) & 46 (37\%) \\ \hline Breech/transverse lie & 11 (10\%) & 9 (7\%) \\ \hline Other & 11 (10\%) & 11 (9\%) & 0.572 \\ \hline Reason for assisted vaginal delivery(1) \\ \hline Fetal distress & 12 (80\%) & 10 (71\%) \\ \hline Other & 3 (20\%) & 4 (29\%) & 0.682 \\ \hline Fetal distress in labor & 38 (9\%) & 33 (8\%) & 0.621 \\ \hline Cesarean delivery for fetal distress & 26 (6\%) & 23 (5\%) & 0.769 \\ \hline Gestational age at delivery (med, min-max) & 39 (23–41.5) & 39 (28.6–41.6) & 0.689 \\ \hline Gestational age distribution \\ \hline <37 & 67 (15\%) & 43 (10\%) \\ \hline 37–40 & 242 (56\%) & 273 (63\%) \\ \hline >40 & 127 (29\%) & 118 (27\%) & 0.024 \\ \hline Gestational age at delivery <37 & 67 (15\%) & 43 (10\%) & 0.015 \\ \hline \end{tabular} \end{table}
PMC2717071_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline & \multicolumn{2}{c|}{\textbf{Group}} \\ \hline & \textbf{Hypoglycemic (n = 436)} & \textbf{Controls (n = 434)} & \textbf{P-value} \\ \hline Birth weight (gm) (med, Q1-Q3) & 3240 (2928–3550) & 3313 (2980–3690) & 0.008 \\ \hline Birth weight distribution \\ \hline <2500 & 43 (10\%) & 22 (5\%) \\ \hline 2500–4000 & 370 (85\%) & 370 (85\%) \\ \hline >4000 & 23 (5\%) & 42 (10\%) & 0.002 \\ \hline IUGR & 36 (12\%) & 29 (9\%) & 0.277 \\ \hline Umbilical artery pH<7.1 & 14 (3\%) & 7 (2\%) & 0.130 \\ \hline 5 minutes Apgar score <7 & 4 (1\%) & 1 (.2\%) & 0.374 \\ \hline Admission to NICU & 36 (8\%) & 25 (6\%) & 0.149 \\ \hline Admission reasons(2) \\ \hline Prematurity & 6 (17\%) & 4 (16\%) \\ \hline RDS/TTN & 26 (72\%) & 12 (48\%) \\ \hline Other(2) & 4 (11\%) & 9 (36\%) & 0.054 \\ \hline \end{tabular} \end{table}
PMC2717071_table_1
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|} \hline \textbf{Outcome} & \textbf{OR} & \textbf{\textbf{95\% CI}} & \textbf{RR} & \textbf{\textbf{95\% CI}} & \textbf{p-value} \\ \hline Preeclampsia & 3.13 & 1.51–6.51 & 2.98 & 1.49–5.78 & 0.002 \\ \hline Induction of labor & 1.75 & 0.83–1.66 & 1.52 & 0.86–1.47 & 0.361 \\ \hline Preterm delivery & 1.61 & 0.92–2.82 & 1.52 & 0.93–2.39 & 0.093 \\ \hline IUGR & 1.24 & 0.73–2.10 & 1.21 & 0.75–1.91 & 0.425 \\ \hline Macrosomia & 0.49 & 0.28–0.85 & 0.51 & 0.30–0.86 & 0.011 \\ \hline Umbilical artery pH<7.1 & 2.00 & 0.76–5.26 & 1.97 & 0.77–4.93 & 0.159 \\ \hline 5 min Apgar score <7 & 1.97 & 0.20–19.91 & 1.97 & 0.20–19.19 & 0.564 \\ \hline NICU admission & 1.27 & 0.62–2.05 & 1.12 & 0.63–1.94 & 0.965 \\ \hline \end{tabular} \end{table}
PMC2717071_table_2
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|} \hline \textbf{Code} & \textbf{Clinician Comments} \\ \hline Assessment of Severity & "By how much the patient describes the itch. Like, if they say, it wakes me up at night, or it keeps me up at night, or it's relentless, or it drives me crazy, I know the itch is severe. Plus, you know, I might ask the patient to grade it on a scale of one to ten, how bad is your itch, with ten being the worst, one is being pretty mild or not present. (...) Oh, just the one to ten scale, that's the only systematic way I can grade itch numerically." "Well, I don't have a scale typically in the clinic. There is no numeric scale that I use, but I go by whether it keeps them up at night, or not. That's typically the threshold. The severity of itching really keeps a patient aware at night, and that's about it. I know that's very subjective, but I don't use anything more quantifiable than itch." \\ \hline Itch & "In psoriasis it's less than it is for atopic dermatitis. It doesn't usually keep them up at night, but it is, in some people, a symptom that is annoying, rather than disabling." "If they're able to sleep at night, or it disables them during the daytime, if they've got to stop what they're doing to scratch. I also – well, I look at their skin to see if there are scratch marks, and if there's other accompanying signs of what we call excoriations, where they're digging at their skin, scratching and digging at their skin." "Itch is a very bothersome symptom for psoriasis and other skin conditions such as eczema. And itch can be more problematic than pain. Itch is constant. Itch is something patients are much more aware of, and they're always scratching themselves to the point where they start to bleed, and their skin gets infected. And it's usually worse at nighttime, because patients are more aware about their body, as opposed to daytime, where people are more – you know, they're more busy at work and things. That's when then get home, then they start to itch more. But I would say itch by far is the number one factor that drives patients crazy." \\ \hline Relevance of itch & "I think it's highly relevant, because it's probably the most day in, day out thing that a lot of people face in that the itching is – comes to the top of forefront of symptomology, whether it's itching in your scalp, or itching on the patches of psoriasis. And it's again probably one of the single most bothersome things, other than the fact that it's there." \\ \hline Location & "Scalp – wherever the plaques are, but scalp drives them crazy. Anywhere on the body." "Is the itch from lesions? Usually, yes." "Commonly hands, knees, ankles." "Their scalp and their lower legs. It can be where there's no lesions in the scalp, but in the lower legs there usually some evidence of dry, scaling skin with some scratch marks." \\ \hline Treatment/management challenges & "Like if the treatment works, that's great, but if it doesn't work, then we've got to keep adding things to help control the itch, whether it be a pill for itch that they take at nighttime, like an antihistamine, or using various creams to keep applying to control the itch... I would probably say maybe 60\% of the time the itch can be controlled with one treatment, whether it be the shots or light therapy. And then 40\% of the time it's not adequate, it's got to add in something else, like a topical cream, to control the itch." "Particular challenges (related to the treatment or management of the itch)? Again, I think it's related to treating the underlying psoriasis itself." "Yes, there's no specific oral anti-itch medication. And some of the topical anti-itch medications are not always effective for long periods of time over large areas of the skin. Effective or feasible. If they have total body involvement, it's hard to – lotions, anti-itch lotions all over their body." \\ \hline \end{tabular} \end{table}
PMC2717072_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|} \hline & \multicolumn{2}{c|}{\textbf{Focus Groups}} \\ \hline & \textbf{Patients with Mild Psoriasis (N = 8)} & \textbf{Patients with Severe Psoriasis (N = 31)} \\ \hline Female sex, n (\%) & 5 (63) & 17 (55) \\ \hline Age, mean years (range) & 36 (20 – 74) & 45 (22 – 66) \\ \hline Race/Ethnicity, n (\%) \\ \hline White & 5 (63) & 24 (77) \\ \hline Black/African American & 0 & 4 (13) \\ \hline Hispanic & 1 (13) & 1 (3) \\ \hline Mexican-American & 1 (13) & 0 \\ \hline Arabic & 1 (13) & 0 \\ \hline Spanish & 0 & 1 (3) \\ \hline Disease Diagnosis, n (\%) \\ \hline Psoriasis & 8 (100) & 29 (94)b \\ \hline Co-existing Psoriatic arthritis & 0 & 1 (3) \\ \hline Heath Status, n (\%) \\ \hline Excellent & 1 (13) & 3 (10) \\ \hline Very good & 4 (50) & 9 (29) \\ \hline Good & 3 (38) & 13 (42) \\ \hline Fair & 0 & 4 (13) \\ \hline Poor & 0 & 2 (7) \\ \hline \end{tabular} \end{table}
PMC2717072_table_1
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|} \hline \textbf{Code/domain} & \textbf{Patient Comment (Severity of Psoriasis)} \\ \hline Symptoms/itch & "You itch a lot. Scratch a lot, I mean." (Severe) "Scratch to relieve." (Severe) "It will spread over my whole body, the itching. I'll get scabs on my knees, on my elbows that (...) like yours (...) are very, very bad, and the more you scratch it, the worse it gets. (...) it just spreads." (Severe) "The worst is, for me, is just the itching. The itch and the dry." (Severe) "My itching, it gets inflamed. (...) It spreads – (...) And the more you scratch – you're scratching – (...) Mainly the itching." (Mild) "Because I'm scratching everywhere, people not knowing the reason why I'm scratching." (Mild) \\ \hline Change of psoriasis symptoms due to anxiety/worsen & "So that's the worst, that's when I start to get really anxious. And it, like I said, it can change over the course of a day. When I know I got to start getting ready for work, that puts me in a whole other frame of mind and I will notice that I'm itching a little bit more and or maybe my hands are not as calm as they are on my days off." (Severe) \\ \hline Change of psoriasis symptoms due to stress/worsen & "Mine only itches when I'm under stress." (Severe) "...I'll be thinking about it way too much, and then I'll start getting – affecting my skin, because the stress will make it outbreak, and then the outbreak, I'll want to itch, and just scratch..." (Severe) \\ \hline Change of psoriasis symptoms over day/varies & "Yeah, for me it changes a lot too... Towards the end of the night is when it's usually more itchy for me." (Severe) \\ \hline Change of psoriasis symptoms over week/varies & "...and then Sunday will hit, and then that's it. Then I'll start itching again, so it's like – and Mondays are so busy at work. And like towards Wednesday – that's – I don't know. It's like Monday and Wednesday. Those two days that – I don't know why those – hate those days. (Severe) "The itching to me varies. (...) Just sometimes I don't even think about it and other times it just, boom, it's just itching." (Severe) \\ \hline Impact on daily activities/difficulty concentrating & "You lose concentration, because you want to scratch and (...) really want to itch this, but you don't want to itch it in front of somebody, and so you trail off to what you were originally helping somebody with, if you're working." (Mild) "Lack of concentration, or itchy – if you're really over-itchy, sometimes it's hard to concentrate on something else other than that whole-body itch." (Severe) \\ \hline Impact on daily activities/choice of clothing & "For some reason whenever I have anything that's 100\% cotton I tend to itch more. It gets irritated more, so everything is based on clothing or cotton. I try to buy a certain type of clothes. So and that's what I got to wear all the time." (Severe) \\ \hline Impact on emotions/embarrassed & "I'm in front of people all day long, and it's incredibly embarrassing to start bleeding in front of someone, or scratching uncontrollably when you're not even thinking about it." (Severe) "Mine is just more of embarrassment. When you're scratching and people see things coming off of you or on your clothing..." (Mild) \\ \hline Impact on sleep/difficulty falling asleep & "Before you go to sleep yeah. (...) Because your itches." (Mild) "It's itching instead of falling asleep." (Severe) "It's falling asleep, when it's itching, and you – and then the minute you start scratching, it only makes it worse. But it's hard...You tell yourself not to scratch, but you think you're going to stop it, you know? And then you scratch it, it only makes it worse, and you want to scratch more, and scratch more. It's bad." (Severe) \\ \hline Impact on sleep/difficulty staying asleep & "Well, no. I'm going to wake up, I'm itchy. I'm going to put some cortisone on, I'm going grease myself down – then I'm going to try and go back to bed." (Severe) "Just, I want to rip my skin off, because it wakes me up. It's like it's never-ending." (Severe) \\ \hline Miss days of school or work because of psoriasis/itch & "Yeah, you go every week and you get shots to stop you from itching." (Severe) "And I had it on my feet really bad, and I actually missed several days of work... Well, it's the itching." (Severe) "I can't just go out there (...) taking the train to work, being around a bunch of people, and coming back home – the whole time I just want to scratch and itch..." (Severe) \\ \hline \end{tabular} \end{table}
PMC2717072_table_2
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline & \textbf{Patients with Mild Disease (N = 8)} & \textbf{Patients with Severe Disease (N = 31)} & \textbf{All Patients (N = 39)} \\ \hline Patients rating itch as the most important symptoma \\ \hline No. of patients, n & 8 & 23 & 31 \\ \hline Mean rating & 9.1 & 8.5 & 8.7 \\ \hline Patients rating a 10, \% & 88\% & 70\% & 74\% \\ \hline Patients rating itch as the most severe symptomb \\ \hline No. of patients, n & 8 & 23 & 31 \\ \hline Mean rating & 5.8 & 8.1 & 7.5 \\ \hline Patients rating a 10, \% & 0\% & 48\% & 35\% \\ \hline Patients rating itch as the most troublesome symptomc \\ \hline No. of patients, n & 8 & 16 & 24 \\ \hline Mean rating & 9.0 & 8.0 & 8.3 \\ \hline Patients rating a 10, \% & 63\% & 50\% & 54\% \\ \hline \end{tabular} \end{table}
PMC2717072_table_3
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|} \hline & \textbf{Total Responses} & \textbf{FG 1 vs FG 2} & \textbf{FG 1–2 vs FG 3} & \textbf{FG 1–3 vs FG 4} & \textbf{FG 1–4 vs FG 5} \\ \hline Symptoms \\ \hline Itch & 19 & 4 vs 4 & 8 vs 3 & 11 vs 5 & 16 vs 3 \\ \hline Bleeding & 13 & 3 vs 5 & 8 vs 1 & 9 vs 3 & 12 vs 1 \\ \hline Cracking & 12 & 0 vs 5 & 5 vs 4 & 9 vs 3 & 12 vs 0 \\ \hline Scaling & 12 & 2 vs 4 & 6 vs 4 & 10 vs 1 & 11 vs 1 \\ \hline Dry skin & 6 & 1 vs 1 & 2 vs 1 & 3 vs 3 & 6 vs 0 \\ \hline Impact on daily activities \\ \hline Choice of clothing & 17 & 2 vs 6 & 8 vs 2 & 10 vs 4 & 14 vs 3 \\ \hline Effects on work & 9 & 3 vs 2 & 5 vs 0 & 5 vs 2 & 7 vs 2 \\ \hline More laundry/replacing clothes and linens & 2 & 2 vs 0 & 2 vs 0 & 2 vs 0 & 2 vs 0 \\ \hline Household duties & 1 & 0 vs 1 & 1 vs 0 & 1 vs 0 & 1 vs 0 \\ \hline Impact on social life \\ \hline Interaction with others & 15 & 3 vs 5 & 8 vs 3 & 11 vs 3 & 14 vs 1 \\ \hline Attending social events & 5 & 0 vs 2 & 2 vs 2 & 4 vs 0 & 4 vs 1 \\ \hline Leisure activities & 4 & 2 vs 1 & 3 vs 0 & 3 vs 1 & 4 vs 0 \\ \hline Impact on sleep \\ \hline Sleeping less than usual & 2 & 2 vs 0 & 2 vs 0 & 2 vs 0 & 2 vs 0 \\ \hline Difficulty waking up and feeling well rested & 1 & 0 vs 1 & 1 vs 0 & 1 vs 0 & 1 vs 0 \\ \hline Impact on emotions \\ \hline Embarrassed & 17 & 5 vs 0 & 5 vs 3 & 8 vs 4 & 12 vs 5 \\ \hline Annoyed & 7 & 2 vs 2 & 4 vs 2 & 6 vs 1 & 7 vs 0 \\ \hline Frustrated & 4 & 0 vs 3 & 3 vs 0 & 3 vs 0 & 3 vs 1 \\ \hline Anxious & 2 & 0 vs 0 & 0 vs 0 & 0 vs 1 & 1 vs 1 \\ \hline Nervous & 1 & 0 vs 0 & 0 vs 1 & 1 vs 0 & 1 vs 0 \\ \hline Impact on sex \\ \hline Sexual activities & 5 & 2 vs 0 & 2 vs 1 & 3 vs 0 & 3 vs 2 \\ \hline Decreased sexual desire & 2 & 2 vs 0 & 2 vs 0 & 2 vs 0 & 2 vs 0 \\ \hline \end{tabular} \end{table}
PMC2717072_table_4
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline & & \multicolumn{2}{c|}{\textbf{Sinus rhythm at 12 +- 3 days}} \\ \hline & \textbf{All} & \textbf{Yes} & \textbf{No} \\ \hline Patients, n & 111 & 56 & 55 \\ \hline Age, years & 67 $\pm$ 12 & 66 $\pm$ 11 & 67 $\pm$ 13 \\ \hline Weight, kg & 86 $\pm$ 20 & 85 $\pm$ 17 & 86 $\pm$ 22 \\ \hline Length, cm & 178 $\pm$ 9 & 177 $\pm$ 9 & 178 $\pm$ 10 \\ \hline BMI & 27 $\pm$ 5 & 27 $\pm$ 5 & 27 $\pm$ 5 \\ \hline Male, n (\%) & 89 (80) & 46 (82) & 43 (78) \\ \hline AF episode duration, months & 5.8 $\pm$ 8.1 & 4.8 $\pm$ 5.4 & 6.9 $\pm$ 10.1 \\ \hline First episode of AF, n & 36 & 20 & 16 \\ \hline Hypothyreosis, n & 2 (2) & 1 (2) & 1 (2) \\ \hline Hyperthyreosis, n & 2 (2) & 2 (4) & 0 \\ \hline Hypertension, n & 45 (41) & 26 (46) & 19 (35) \\ \hline Angina pectoris, n & 18 (16) & 10 (18) & 8 (15) \\ \hline Previous myocardial infarction, n & 17 (15) & 7 (13) & 10 (18) \\ \hline Previous CABG, n & 12 (11) & 7 (13) & 5 (9) \\ \hline Previous PCI, n & 9 (8) & 3 (5) & 6 (11) \\ \hline Diabetes mellitus, n & 13 (12 & 5 (9) & 8 (15) \\ \hline Heart failure, n & 25 (23) & 13 (23) & 12 (22) \\ \hline Dilated cardiomyopathy, n & 11 (10) & 6 (11) & 5 (9) \\ \hline Hypertrophic cardiomyopathy, n & 3 (3) & 3 (5) & 0 \\ \hline Stroke, n & 6 (5) & 3 (5) & 3 (5) \\ \hline TIA, n & 7 (6) & 0 & 7 (13) \\ \hline Venous thrombosis, n & 1 (1) & 1 (2) & 0 \\ \hline Pulmonary embolism, n & 1 (1) & 1 (2) & 0 \\ \hline Peripheral arterial embolism, n & 1 (1) & 1 (2) & 0 \\ \hline \end{tabular} \end{table}
PMC2717073_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|} \hline \multirow{2}{*}{\textbf{New symptoms scale}} & \multirow{2}{*}{\textbf{ICC (AF at 12 $\pm$ 3 days)}} & \multirow{2}{*}{\textbf{Lower 95\% CI limit for ICC}} \\ \hline \\ \hline Dyspnoea at rest & 0.82 & 0.61 \\ \hline Dyspnoea on exertion & 0.88 & 0.72 \\ \hline Limitations in daily life due to AF & 0.19 & Neg \\ \hline Discomfort due to AF & 0.04 & Neg \\ \hline Fatigue due to AF & 0.39 & Neg \\ \hline Anxiety due to AF & 0.93 & 0.83 \\ \hline SF-36 domains \\ \hline Physical functioning & 0.84 & 0.64 \\ \hline Role – Physical & 0.56 & 0.17 \\ \hline Bodily pain & 0.50 & 0.09 \\ \hline General Health & 0.75 & 0.45 \\ \hline Vitality & 0.77 & 0.49 \\ \hline Social functioning & 0.54 & 0.14 \\ \hline Role – Emotional & 0.57 & 0.18 \\ \hline Mental Health & 0.95 & 0.10 \\ \hline \end{tabular} \end{table}
PMC2717073_table_1
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|l|l|} \hline \textbf{Items} & \textbf{Dyspnoea at rest} & \textbf{Dyspnoea on exertion} & \textbf{Limitations in working} & \textbf{Limitations in daily life} & \textbf{Discomfort due to AF} & \textbf{Fatiguedue to AF} & \textbf{Anxiety due to AF} \\ \hline pf_tran & -0.36437 & -0.58810 & -0.12466 & -0.61232 & -0.20312 & -0.48616 & -0.24267 \\ \hline Physical functioning & < .0001 & < .0001 & 0.4315 & < .0001 & 0.0325 & < .0001 & 0.0106 \\ \hline n & 111 & 111 & 42 & 111 & 111 & 111 & 110 \\ \hline rp_tran & -0.35569 & -0.47634 & -0.20069 & -0.62755 & -0.22794 & -0.49356 & -0.31813 \\ \hline Role – Physical & 0.0001 & < .0001 & 0.2025 & < .0001 & 0.0171 & < .0001 & 0.0008 \\ \hline n & 109 & 109 & 42 & 108 & 109 & 109 & 108 \\ \hline bp_tran & -0.44545 & -0.26582 & -0.34962 & -0.37650 & -0.31149 & -0.32431 & -0.38909 \\ \hline Bodily Pain & < .0001 & 0.0048 & 0.0232 & < .0001 & 0.0009 & 0.0005 & < .0001 \\ \hline n & 111 & 111 & 42 & 110 & 111 & 111 & 109 \\ \hline gh_tran & -0.29357 & -0.27723 & -0.29889 & -0.51705 & -0.31705 & -0.40835 & -0.38909 \\ \hline General Health & 0.0019 & 0.0034 & 0.0545 & < .0001 & 0.0007 & < .0001 & < .0001 \\ \hline n & 110 & 110 & 42 & 109 & 110 & 110 & 109 \\ \hline v_tran & -0.25704 & -0.40008 & -0.40877 & -0.66652 & -0.40433 & -0.66056 & -0.36696 \\ \hline Vitality & 0.0084 & < .0001 & 0.0120 & < .0001 & < .0001 & < .0001 & 0.0001 \\ \hline n & 104 & 104 & 37 & 103 & 104 & 104 & 103 \\ \hline sf_tran & -0.14190 & -0.25434 & -0.08276 & -0.46915 & -0.38437 & -0.42230 & -0.37927 \\ \hline Social Functioning & 0.1374 & 0.0071 & 0.6023 & < .0001 & < .0001 & < .0001 & < .0001 \\ \hline n & 111 & 111 & 42 & 110 & 111 & 111 & 110 \\ \hline re-tran & -0.32767 & -0.37072 & 0.11359 & -0.52260 & -0.21609 & -0.48442 & -0.42472 \\ \hline Role – Emotional & 0.0004 & < .0001 & 0.4738 & < .0001 & 0.0227 & < .0001 & < .0001 \\ \hline n & 111 & 111 & 42 & 110 & 111 & 111 & 103 \\ \hline mh_tran & -0.14611 & -0.21271 & -0.21615 & -0.37553 & -0.40701 & -0.44899 & -0.62826 \\ \hline Mental Health & 0.1389 & 0.0302 & 0.1988 & < .0001 & < .0001 & < .0001 & < .0001 \\ \hline n & 104 & 104 & 37 & 103 & 104 & 104 & 103 \\ \hline \end{tabular} \end{table}
PMC2717073_table_2
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|l|l|l|} \hline \textbf{Item number} & \textbf{Raw count} & \textbf{Measure} & \textbf{Realse} & \multicolumn{2}{c|}{\textbf{Infit}} & \multicolumn{2}{c|}{\textbf{Outfit}} & \textbf{Score} \\ \hline & & & & \textbf{\textbf{MNSQ}} & \textbf{\textbf{ZSTD}} & \textbf{\textbf{MNSQ}} & \textbf{\textbf{ZSTD}} & \textbf{corr.} \\ \hline AF1 & 108 & 0,41 & 0,08 & 0,98 & -0,1 & 0,99 & 0 & 0,51 \\ \hline AF3 & 40 & 0,22 & 0,17 & 0,89 & -0,4 & 1,28 & 0,4 & 0,39 \\ \hline AF7 & 107 & 0,15 & 0,05 & 1,04 & 0,2 & 1,01 & 0 & 0,65 \\ \hline AF5 & 108 & 0,12 & 0,05 & 1,06 & 0,4 & 1 & 0 & 0,66 \\ \hline AF4 & 107 & -0,06 & 0,05 & 0,84 & -1,2 & 0,79 & -1,1 & 0,76 \\ \hline AF2 & 108 & -0,4 & 0,05 & 1,24 & 1,7 & 1,2 & 1,2 & 0,69 \\ \hline AF6 & 108 & -0,43 & 0,05 & 0,87 & -1 & 0,84 & -1,2 & 0,78 \\ \hline Mean & 98 & 0 & 0,07 & 0,99 & -0,1 & 1,01 & -0,1 \\ \hline SD & 24 & 0,29 & 0,04 & 0,13 & 0,9 & 0,16 & 0,8 \\ \hline \end{tabular} \end{table}
PMC2717073_table_3
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|} \hline \textbf{Score} & \textbf{Description} \\ \hline 0 & No lesion \\ \hline 1 & Hyperaemic area with erected pili \\ \hline 2 & Moist, exudative and hyperaemic area with intact epidermis \\ \hline 3 & Exudative area, exposed corium with no signs of healing \\ \hline 4 & Exposed corium but in process of healing, dried-up lesion \\ \hline 5 & Dark brown scab, completely or almost completely healed lesion \\ \hline \end{tabular} \end{table}
PMC2717074_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|} \hline N° of cases \\ \hline Total & 68 \\ \hline Distribution of parity groups (\%) \\ \hline Primiparous & 75.0 \\ \hline Multiparous & 25.0 \\ \hline Distribution of lactation stage groups (\%) \\ \hline DIM* 0–120 & 35.3 \\ \hline DIM 121–240 & 38.2 \\ \hline DIM > 240 & 26.5 \\ \hline \end{tabular} \end{table}
PMC2717074_table_1
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|} \hline & \textbf{Median duration} \\ \hline No stratification & 42 (36–48) \\ \hline Stratification \\ \hline Primiparous & 39 (35–48) \\ \hline Multiparous & 48 (42–48) \\ \hline Lactation stage at lesion onset \\ \hline DIM* 0–120 & 42 (39–56) \\ \hline DIM 121–240 & 42 (35–48) \\ \hline DIM > 240 & 41 (35–48) \\ \hline \end{tabular} \end{table}
PMC2717074_table_2
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline & \textbf{Pre-contrast} & \textbf{Post-contrast} & \textbf{CER*} \\ \hline Triolein Group (n = 12) & 504 (56.5) & 1793 (229.9) & 2.61 (0.73) \\ \hline Saline Group (n = 18) & 582 (519.1) & 712 (704.0) & 0.22 (0.37) \\ \hline \end{tabular} \end{table}
PMC2717075_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|} \hline \textbf{HPVgenotype} & \textbf{Primer sequences} & \textbf{Amplicon (pb)*} \\ \hline 6/11 & TGC AAG AAT GCA CTG ACC AC TGC ATG TTG TCC AGC AGT GT & 334 \\ \hline 16 & CAC AGT TAT GCA CAG AGC TGC CAT ATA TTC ATG CAA TGT AGG TGT A & 457 \\ \hline 18 & CAC TTC ACT GCA AGA CAT AGA GTT GTG AAA TCG TCG TTT TTC A & 332 \\ \hline 31 & GAA ATT GCA TGA ACT AAG CTC G CAC ATA TAC CTT TGT TTG TCA A & 263 \\ \hline 33 & ACT ATA CAC AAC ATT GAA CTA GTT TTT ACA CGT CAC AGT GCA & 398 \\ \hline 42 & CCC AAA GTA GTG GTC CCA GTT A GAT CTT TCG TAG TGT CGC AGT G & 277 \\ \hline 52 & TAA GGC TGC AGT GTG TGC AG CTA ATA GTT ATT TCA CTT AAT GGT & 229 \\ \hline 58 & GTA AAG TGT GCT TAC GAT TGC GTT GTT ACA GGT TAC ACT TGT & 274 \\ \hline \end{tabular} \end{table}
PMC2717078_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline \multicolumn{4}{c|}{\textbf{HPV-DNA}} \\ \hline \textbf{Type n = 18} & \textbf{Carcinogenic risk} & \textbf{Frequency n = 82} & \textbf{\%} \\ \hline 6/11 & LR & 17 & 20.7 \\ \hline 42 & LR & 13 & 15.9 \\ \hline 16 & HR & 13 & 15.9 \\ \hline 18 & HR & 9 & 11 \\ \hline 58 & HR & 5 & 6.1 \\ \hline 31 & HR & 3 & 3.7 \\ \hline 35 & HR & 3 & 3.7 \\ \hline 52 & HR & 3 & 3.7 \\ \hline 51 & HR & 2 & 2.4 \\ \hline 54 & LR & 2 & 2.4 \\ \hline 59 & HR & 2 & 2.4 \\ \hline 26 & PHR & 1 & 1.2 \\ \hline 33 & HR & 1 & 1.2 \\ \hline 34 & HR & 1 & 1.2 \\ \hline 45 & HR & 1 & 1.2 \\ \hline 68 & HR & 1 & 1.2 \\ \hline 70 & LR & 1 & 1.2 \\ \hline 73 & HR & 1 & 1.2 \\ \hline NC* & - & 3 & 3.7 \\ \hline \end{tabular} \end{table}
PMC2717078_table_1
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|} \hline \textbf{Cohort (n = 223)} & \textbf{Characteristic} & \textbf{aSer/Ser (n = 170)} & \textbf{aSer/Leu (n = 43)} & \textbf{aLeu/Leu (n = 10)} \\ \hline No (\%) of patients & Co-existing diseases \\ \hline 103 (46.2) & Arterial hypertension & 77 (74.8) & 22 (21.4) & 4 (3.9) \\ \hline 82 (36.8) & Myocardial disease & 67 (81.7) & 14 (17.0) & 1 (1.2) \\ \hline 53 (23.8) & Diabetes & 35 (66.0) & 14 (26.0) & 4 (7.5) \\ \hline 52 (23.3) & Lung pathology & 44 (84.6) & 6 (11.5) & 2 (3.8) \\ \hline 16 (7.2) & Renal pathology & 11 (68.8) & 4 (25.0) & 1 (6.3) \\ \hline No (\%) of patients & Type of surgery \\ \hline 76 (34.1) & Upper-GI resection & 58 (76.3) & 16 (21.1) & 2 (2.6) \\ \hline 62 (27.8) & Colorectal resection & 46 (74.2) & 12 (19.4) & 4 (6.5) \\ \hline 50 (22.4) & bOther abdominal & 37 (74.0) & 10 (20.0) & 3 (6.0) \\ \hline 15 (6.7) & Thoracic & 11 (73.4) & 3 (20.0) & 1 (6.7) \\ \hline 20 (9.0) & Limb and others & 18 (90.0) & 2 (10.0) & - - \\ \hline No (\%) of infections & Type of Infection \\ \hline 92 (41.3) & Pneumonia & 68 (73.9) & 20 (21.7) & 4 (4.3) \\ \hline 38 (17.0) & Peritonitis & 27 (71.1) & 9 (23.7) & 2 (5.3) \\ \hline 65 (29.2) & Abscess & 52 (80.0) & 10 (15.4) & 3 (4.6) \\ \hline 4 (1.8) & Urinary tract infections & 3 (75.0) & 1 (25.0) & - - \\ \hline 24 (10.8) & Other & 20 (83.3) & 3 (12.5) & 1 (4.2) \\ \hline No (\%) of infectionsc & Microorganisms \\ \hline 129 (57.9) & Gram-negative & 97 (75.2) & 25 (19.4) & 7 (5.4) \\ \hline 83 (37.2) & Gram-positive & 60 (72.3) & 18 (21.7) & 5 (6.0) \\ \hline 15 (6.7) & Fungi & 13 (86.7) & 2 (13.3) & - - \\ \hline 31 (13.9) & Polymicrobial & 19 (61.3) & 9 (29.0) & 3 (9.8) \\ \hline 24 (10.8) & Clinically diagnosed & 15 (62.5) & 8 (33.3) & 1 (4.2) \\ \hline No (\%) of patients & Morbidity and Mortality \\ \hline 114 (51.1) & Sepsis without organ dysfunction & 90 (78.9) & 22 (19.3) & 2 (1.8) \\ \hline 109 (48.9) & Severe sepsis and septic shock & 80 (73.4) & 21 (19.3) & 8 (7.3)d \\ \hline 28 (12.6) & Mortality ICU & 21 (75.0) & 6 (21.4) & 1 (3.6) \\ \hline 34 (15.3) & Mortality hospital & 26 (76.5) & 7 (20.6) & 1 (2.9) \\ \hline \end{tabular} \end{table}
PMC2717080_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|l|} \hline & & & \multicolumn{3}{c|}{\textbf{\textbf{No.} of individuals with genotype (\%)}} \\ \hline \textbf{Population and disease} & \textbf{No.} & \textbf{Variant Allele Frequency (\%)} & \textbf{Ser/Ser} & \textbf{Ser/Leu} & \textbf{Leu/Leu} & \textbf{P valuea} \\ \hline Ghana, delivering women \\ \hline P. falciparum positive & 541 & 0.1 & 540 (99.8) & 1 (0.2) & 0 (0) & 0.49 \\ \hline P. falciparum negative & 554 & 0 & 554 (100) & 0 (0) & 0 (0) \\ \hline Germany \\ \hline Sepsis patients & 223 & 18.1 & 170 (76.2) & 43 (19.3) & 10 (4.5) & 0.19 \\ \hline Controls & 188 & 19.2 & 138 (74.4) & 48 (25.5) & 2 (1.1)b \\ \hline Bangladesh \\ \hline Leprosy patients & 263 & 16.3 & 186 (70.7) & 68 (25.9) & 9 (3.4) & 0.22 \\ \hline Controls & 280 & 17.2 & 188 (67.1) & 88 (31.5) & 4 (1.4) \\ \hline Turkey & & & & & & 0.11 \\ \hline Leprosy patients & 60 & 10.8 & 47 (78) & 13 (21) & 0 (0) \\ \hline Controls & 100 & 6.5 & 88 (88) & 11 (11) & 1 (1) \\ \hline \end{tabular} \end{table}
PMC2717080_table_1
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|l|} \hline & \multicolumn{6}{c|}{\textbf{Particle size (nm) ($\pm$ SD)}} \\ \hline \textbf{Samples} & \textbf{N/P = 1} & \textbf{N/P = 3} & \textbf{N/P = 5} & \textbf{N/P = 7} & \textbf{N/P = 1}0 & \textbf{N/P = 1}5 \\ \hline PCFC-g-PEI/pDNA complexes & 208.05 $\pm$ 15.55 & 211.85 $\pm$ 11.95 & 215.3 $\pm$ 12.2 & 195.35 $\pm$ 6.95 & 161.4 $\pm$ 23.2 & 234.85 $\pm$ 10.25 \\ \hline PEI/pDNA complexes & 118.5 $\pm$ 2.5 & 88.89 $\pm$ 0.83 & 99.115 $\pm$ 3.885 & 136.35 $\pm$ 4.45 & 159.1 $\pm$ 5.7 & 98.59 $\pm$ 9.81 \\ \hline \end{tabular} \end{table}
PMC2717081_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|l|} \hline & \multicolumn{6}{c|}{\textbf{Zeta potential (mV) ($\pm$ SD)}} \\ \hline \textbf{Samples} & \textbf{N/P = 1} & \textbf{N/P = 3} & \textbf{N/P = 5} & \textbf{N/P = 7} & \textbf{N/P = 1}0 & \textbf{N/P = 1}5 \\ \hline PCFC-g-PEI/pDNA complexes & 31.2 $\pm$ 2.1 & 16.75 $\pm$ 0.85 & 1.5125 $\pm$ 0.6575 & 1.38 $\pm$ 0.02 & 0.325 $\pm$ 0.19 & 7.835 $\pm$ 1.675 \\ \hline PEI/pDNA complexes & 25.15 $\pm$ 0.75 & 21.25 $\pm$ 0.25 & 13 $\pm$ 0.7 & 14.8 $\pm$ 1.5 & 1.855 $\pm$ 0.235 & 0.651 $\pm$ 0.062 \\ \hline \end{tabular} \end{table}
PMC2717081_table_1
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|} \hline & \textbf{Mean} & \textbf{Minimum} & \textbf{Maximum} & \textbf{SD} \\ \hline Age (year) & 27.12 & 19 & 40 & 4.84 \\ \hline Gestational age (week) & 33.70 & 5 & 42 & 9.50 \\ \hline HCHB1 (g/l) & 126.35 & 55 & 163 & 18.02 \\ \hline LAHB2 (g/l) & 128.45 & 78 & 162 & 14.84 \\ \hline \end{tabular} \end{table}
PMC2717084_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|} \hline \textbf{Characteristics} & \textbf{\%} \\ \hline Age group \\ \hline 15–19 & 35.8 \\ \hline 20–24 & 49.2 \\ \hline 25–29 & 12.7 \\ \hline 30 and above & 2.3 \\ \hline Median age & 21.0 \\ \hline Marital status \\ \hline Unmarried & 88.3 \\ \hline Currently married & 11.7 \\ \hline Districts \\ \hline Kathmandu valley (3 districts) & 9.2 \\ \hline Outside Kathmandu valley (64 districts) & 90.8 \\ \hline Level of education \\ \hline Intermediate & 27.7 \\ \hline Undergraduate & 53.9 \\ \hline Graduate degree & 18.3 \\ \hline Type of accommodation \\ \hline With family & 41.0 \\ \hline Alone & 19.0 \\ \hline With friends & 40.0 \\ \hline Total & 100.0 \\ \hline N & 573 \\ \hline \end{tabular} \end{table}
PMC2717085_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|} \hline & \textbf{\%} \\ \hline Experience of kissing a girl & 57.4 \\ \hline Experience of dating & 44.5 \\ \hline Experience of placing hand on a girl's breast & 60.2 \\ \hline Experience of placing hand on a girl's sex organ & 34.9 \\ \hline Experience of sexual intercourse & 46.9 \\ \hline Experience of premarital sex & 39.1 \\ \hline Having close unmarried friend with experience of premarital sex & 53.0 \\ \hline N & 573 \\ \hline \end{tabular} \end{table}
PMC2717085_table_1
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|} \hline & \multicolumn{2}{c|}{\textbf{Premarital sex}} & \multicolumn{2}{c|}{\textbf{Total}} \\ \hline & \textbf{Yes} & \textbf{No} & \textbf{\%} & \textbf{Number} \\ \hline Age group \\ \hline 15–19 & 34.6 & 65.4 & 100.0 & 205 \\ \hline 20 and above & 41.6 & 58.4 & 100.0 & 368 \\ \hline Level of education \\ \hline Intermediate & 35.2 & 64.8 & 100.0 & 159 \\ \hline Undergraduate & 39.8 & 60.2 & 100.0 & 309 \\ \hline Graduate degree & 42.9 & 57.1 & 100.0 & 105 \\ \hline Marital status \\ \hline Married & 32.8 & 67.2 & 100.0 & 67 \\ \hline Unmarried & 39.9 & 60.1 & 100.0 & 506 \\ \hline District \\ \hline Outside Kathmandu valley & 39.8 & 60.2 & 100.0 & 520 \\ \hline Kathmandu valley & 32.1 & 67.9 & 100.0 & 53 \\ \hline Living arrangement \\ \hline With family & 36.6 & 63.4 & 100.0 & 232 \\ \hline Alone & 43.4 & 56.6 & 100.0 & 106 \\ \hline With friends & 39.6 & 60.4 & 100.0 & 235 \\ \hline Attitude towards female virginity*** \\ \hline Conservative & 33.4 & 66.6 & 100.0 & 305 \\ \hline Liberal & 45.5 & 54.5 & 100.0 & 268 \\ \hline Attitude towards male virginity*** \\ \hline Conservative & 30.0 & 70.0 & 100.0 & 290 \\ \hline Liberal & 48.4 & 51.6 & 100.0 & 283 \\ \hline Family structure \\ \hline Joint family & 39.6 & 60.4 & 100.0 & 139 \\ \hline Nuclear family & 38.9 & 61.1 & 100.0 & 434 \\ \hline Religion* \\ \hline \textbf{No}n-Hindu & 20.0 & 80.0 & 100.0 & 35 \\ \hline Hindu & 40.3 & 59.7 & 100.0 & 538 \\ \hline Has a friend who has experienced premarital sex*** \\ \hline \textbf{No} & 14.9 & 85.1 & 100.0 & 268 \\ \hline \textbf{Yes} & 60.3 & 39.7 & 100.0 & 305 \\ \hline \textbf{Total} & 39.1 & 60.9 & 100.0 & 573 \\ \hline \end{tabular} \end{table}
PMC2717085_table_2
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|} \hline & \textbf{\%} \\ \hline Below 15 yrs. & 6.7 \\ \hline 15–16 & 25.0 \\ \hline 17–18 & 32.0 \\ \hline 19 or more & 36.3 \\ \hline Total (age range 10–25 years) & 100.0 \\ \hline N & 224 \\ \hline \end{tabular} \end{table}
PMC2717085_table_3
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|} \hline \textbf{How many sex partners did you have (total)?} & \textbf{\%} \\ \hline One & 45.1 \\ \hline Two & 23.7 \\ \hline Three and more & 31.3 \\ \hline Average number of sex partners & 2.4 \\ \hline SD & 2.1 \\ \hline Ranges & 1–15 \\ \hline Total & 100.0 \\ \hline N & 224 \\ \hline \end{tabular} \end{table}
PMC2717085_table_4
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|} \hline & \textbf{\%} \\ \hline Have you ever had sex with CSW? \\ \hline Yes & 22.8 \\ \hline No & 77.2 \\ \hline Total & 100.0 \\ \hline N & 224 \\ \hline How often did you use condom with CSW? \\ \hline Every act of sexual intercourse & 49.0 \\ \hline Sometimes & 45.1 \\ \hline Never & 5.9 \\ \hline Total & 100.0 \\ \hline N & 51 \\ \hline \end{tabular} \end{table}
PMC2717085_table_5
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline & \textbf{Model I} & \textbf{Model I}I & \textbf{Model I}II \\ \hline Individual characteristics \\ \hline Age group \\ \hline 15–19 & 1.0 & 1.0 & 1.0 \\ \hline 20 and above & 1.34 & 1.39 & 1.69* \\ \hline Level of education \\ \hline Intermediate & 1.0 & 1.0 & 1.0 \\ \hline Undergraduate & 0.93 & 0.89 & 0.52* \\ \hline Graduate degree & 0.88 & 0.79 & 0.48* \\ \hline Marital status \\ \hline Married & 1.0 & 1.0 & 1.0 \\ \hline Unmarried & 1.30 & 1.29 & 1.73 \\ \hline District \\ \hline Outside Kathmandu valley & 1.0 & 1.0 & 1.0 \\ \hline Kathmandu valley & 0.82 & 0.84 & 0.97 \\ \hline Living arrangement \\ \hline With family & 1.0 & 1.0 & 1.0 \\ \hline Alone & 1.32 & 1.39 & 1.28 \\ \hline With friends & 1.05 & 1.07 & 1.07 \\ \hline Attitude towards male virginity \\ \hline Conservative (ref) & 1.0 & 1.0 & 1.0 \\ \hline Liberal & 2.16*** & 2.15*** & 1.91** \\ \hline Family characteristics \\ \hline Family structure \\ \hline Joint family & & 1.0 & 1.0 \\ \hline Nuclear family & & 0.91 & 0.81 \\ \hline Religion \\ \hline Non-Hindu (ref) & & 1.0 & 1.0 \\ \hline Hindu & & 2.63* & 2.99* \\ \hline Peer characteristics \\ \hline Has close unmarried friend who has experienced premarital sex \\ \hline No (ref) & & & 1.0 \\ \hline Yes & & & 9.2*** \\ \hline Intercept & 0.28 & 0.124 & 0.033 \\ \hline -2 log likelihood & 741.7 & 736.1 & 611.1 \\ \hline Cox & Snell R square & 0.043 & 0.052 & 0.238 \\ \hline \end{tabular} \end{table}
PMC2717085_table_6
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|} \hline & \textbf{Method} & \textbf{Threshold} & \textbf{Clusters} & \textbf{Singletons} & \textbf{Max. cluster size} \\ \hline Rice & sHYB & N/A & 305 & 0 & 2,533 \\ \hline \multirow{6}{*}{Rice} & HYB & 1.1 & 2 & 21 & 22,459 \\ \hline & 1.2 & 50 & 36 & 22,078 \\ \hline & 1.35 & 853 & 286 & 10,773 \\ \hline & 1.4 & 1,361 & 528 & 4,052 \\ \hline & 1.45 & 1,863 & 880 & 359 \\ \hline & 1.5 & 2,341 & 1,405 & 143 \\ \hline \multirow{8}{*}{Rice} & RESTR & 1e-8 & 128 & 125 & 21,663 \\ \hline & 1e-10 & 1,247 & 357 & 258 \\ \hline & 1e-12 & 1,929 & 855 & 122 \\ \hline & 1e-15 & 2,959 & 3,007 & 79 \\ \hline & 1e-17 & 3,421 & 5,799 & 67 \\ \hline & 1e-20 & 3,085 & 12,399 & 59 \\ \hline & 1e-25 & 680 & 20,925 & 12 \\ \hline & 1e-30 & 8 & 22,470 & 2 \\ \hline Rice & RAND & N/A & 1,901 & 0 & 113 \\ \hline Barley & sHYB & N/A & 70 & 0 & 1,413 \\ \hline \multirow{3}{*}{Barley} & HYB & 1.5 & 311 & 141 & 14,471 \\ \hline & 1.6 & 318 & 211 & 14,375 \\ \hline & 1.7 & 2,124 & 988 & 2,880 \\ \hline \end{tabular} \end{table}
PMC2717093_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|} \hline & \textbf{Clones} & \textbf{Contigs} & \textbf{Singl.} & \textbf{Q-contigs} \\ \hline Rice FPC Standard & 22,486 & 1,918 & 860 & 8 \\ \hline Rice Comp. sHYB & 22,486 & 2,032 & 1,156 & 6 \\ \hline Rice Comp. HYB & 22,486 & 2,070 & 2,593 & 3 \\ \hline Rice Comp. RESTR & 22,486 & 1,918 & 860 & 8 \\ \hline Rice Comp. RAND & 22,486 & 1,994 & 862 & 6 \\ \hline Barley FPC Standard & 61,647 & 8,852 & 8,821 & 869 \\ \hline Barley Comp. sHYB & 61,647 & 9,316 & 10,866 & 601 \\ \hline Barley Comp. HYB & 61,647 & 9,376 & 13,024 & 489 \\ \hline \end{tabular} \end{table}
PMC2717093_table_1
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|} \hline & \textbf{Assembly score (\%)} & \textbf{Misplaced clones} & \textbf{Misass. contigs} & \textbf{Global ordering} \\ \hline FPC Standard & 96.43 & 675 & 493 & 0.8252 \\ \hline Comp. sHYB & 97.67 & 343 & 290 & 0.8496 \\ \hline Comp. HYB & 99.75 & 10 & 7 & 0.8575 \\ \hline Comp. RESTR & 96.43 & 675 & 473 & 0.8254 \\ \hline Comp. RAND & 96.48 & 668 & 492 & 0.8252 \\ \hline \end{tabular} \end{table}
PMC2717093_table_2
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline & \textbf{MTP clones} & \textbf{Coverage (\%)} & \textbf{Overlaps (\%)} \\ \hline FPC Standard & 2,791 & 84.89 & 84.31 \\ \hline Comp. sHYB & 2,874 & 85.66 & 86.94 \\ \hline Comp. HYB & 2,810 & 85.89 & 94.05 \\ \hline Comp. RESTR & 2,792 & 84.85 & 84.33 \\ \hline Comp. RAND & 2,856 & 85.08 & 83.75 \\ \hline \end{tabular} \end{table}
PMC2717093_table_3
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline & \textbf{TP (\%)} & \textbf{FN (\%)} & \textbf{Singl. (\%)} \\ \hline Rice FPC Standard & 88.91 & 8.53 & 2.56 \\ \hline Rice Comp. sHYB & 87.90 & 7.05 & 5.05 \\ \hline Rice Comp. HYB & 83.87 & 1.90 & 14.23 \\ \hline Rice Comp. RESTR & 88.91 & 8.53 & 2.56 \\ \hline Rice Comp. RAND & 87.80 & 9.64 & 2.56 \\ \hline Rice Manual & 92.09 & 7.26 & 0.65 \\ \hline Barley Standard & 82.27 & 9.63 & 8.10 \\ \hline Barley Comp. sHYB & 82.55 & 9.25 & 8.20 \\ \hline Barley Comp. HYB & 72.55 & 9.06 & 18.40 \\ \hline \end{tabular} \end{table}
PMC2717093_table_4
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|l|} \hline & \multicolumn{3}{c|}{\textbf{Day care attendees (N = 61)}} & \multicolumn{3}{c|}{\textbf{All participants (N = 213)}} \\ \hline \textbf{Serotype} & \textbf{\textbf{DCC1}} & \textbf{\textbf{DCC2}} & \textbf{\textbf{DCC3}} & \textbf{\textbf{DCC1}} & \textbf{\textbf{DCC2}} & \textbf{\textbf{DCC3}} \\ \hline 9V & 15 & 0 & 0 & 21 & 0 & 0 \\ \hline 18C & 0 & 0 & 13 & 0 & 0 & 20 \\ \hline 3 & 9 & 2 & 6 & 11 & 2 & 6 \\ \hline 19F & 0 & 8 & 0 & 1 & 14 & 1 \\ \hline 15B/C & 2 & 4 & 5 & 3 & 6 & 6 \\ \hline 11A & 1 & 2 & 3 & 1 & 4 & 7 \\ \hline 19A & 7 & 0 & 0 & 8 & 0 & 0 \\ \hline 35F & 3 & 2 & 0 & 3 & 4 & 1 \\ \hline 14 & 0 & 2 & 2 & 0 & 4 & 3 \\ \hline 6B & 1 & 1 & 0 & 1 & 4 & 1 \\ \hline 22 & 0 & 2 & 0 & 0 & 4 & 0 \\ \hline 33 & 2 & 0 & 0 & 3 & 0 & 0 \\ \hline 38 & 2 & 0 & 0 & 2 & 0 & 0 \\ \hline 6A & 1 & 1 & 0 & 1 & 1 & 0 \\ \hline 9N & 0 & 0 & 1 & 0 & 1 & 1 \\ \hline 10 & 1 & 0 & 0 & 1 & 0 & 0 \\ \hline 16 & 1 & 0 & 0 & 1 & 0 & 0 \\ \hline 18B & 0 & 1 & 0 & 0 & 1 & 0 \\ \hline 35B & 0 & 0 & 1 & 0 & 0 & 1 \\ \hline 7 & 0 & 0 & 1 & 0 & 0 & 1 \\ \hline Non-typables & 0 & 0 & 0 & 0 & 3 & 3 \\ \hline Total & 45 & 23 & 30 & 57 & 48 & 51 \\ \hline \end{tabular} \end{table}
PMC2717096_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline \textbf{Model parameter} & \textbf{Posterior mean} & \textbf{5\% quantile} & 9\textbf{5\% quantile} \\ \hline κ Community acquisition rate (per month) & 0.0059 & 0.0043 & 0.0077 \\ \hline βfam Family transmission rate (per month) & 0.36 & 0.23 & 0.52 \\ \hline βdcc DCC transmission rate (per month) & 0.53 & 0.38 & 0.71 \\ \hline μ Clearance rate (per month) & 0.69 & 0.64 & 0.75 \\ \hline θ Competition parameter & 0.68 & 0.35 & 1.10 \\ \hline η Relative susceptibility (adults vs. children) & 0.41 & 0.28 & 0.58 \\ \hline δ Relative clearance rate (adults vs. children) & 1.23 & 1.06 & 1.41 \\ \hline \end{tabular} \end{table}
PMC2717096_table_1
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|l|} \hline & \multicolumn{2}{c|}{\textbf{Vaginal (V19I, V12I, V11I)}} & \multicolumn{2}{c|}{\textbf{Ectocervical (3ECI)}} & \multicolumn{2}{c|}{\textbf{Endocervical (sA2EN)}} \\ \hline & \textbf{\textbf{\textbf{MOI 10}}} & \textbf{\textbf{\textbf{PBS}}} & \textbf{\textbf{\textbf{MOI 10}}} & \textbf{\textbf{\textbf{PBS}}} & \textbf{\textbf{\textbf{MOI 10}}} & \textbf{\textbf{\textbf{PBS}}} \\ \hline IL-6 & 127 $\pm$ 13.1* & 69 $\pm$ 1.7 & 63.7 $\pm$ 1.8* & 21.3 $\pm$ 2.4 & 348 $\pm$ 13* & 196 $\pm$ 15 \\ \hline IL-8 & 1458 $\pm$ 117* & 785 $\pm$ 11.3 & 3304 $\pm$ 300* & 722 $\pm$ 98 & 5e7 $\pm$ 1347* & 6e4 $\pm$ 367 \\ \hline G-CSF & 261 $\pm$ 46 & 227 $\pm$ 37 & 548 $\pm$ 143 & 779 $\pm$ 122 & 155 $\pm$ 6.2* & 93 $\pm$ 21 \\ \hline GM-CSF & 24 $\pm$ 1.8* & 8 $\pm$ 3.1 & 16 $\pm$ 2.6 & 10 $\pm$ 1.0 & 160 $\pm$ 9.4* & 45 $\pm$ 12 \\ \hline MCP-1 & 5.8 $\pm$ 1.4 & 7 $\pm$ 2.1 & 11.4 $\pm$ 1.3 & 10 $\pm$ 3.1 & 7.2 $\pm$ 1.1* & 0.46 $\pm$ 0.02 \\ \hline \end{tabular} \end{table}
PMC2717097_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline & \textbf{Primer combinations used} & \textbf{Size of the expected PCR product [bp]} & \textbf{PCR product obtained} \\ \hline GI1 & GI1–1/GI1–2 & 1,331 & - \\ \hline GI1* & GI1–2/GI1–3 & 677 & + \\ \hline GI2 & GI2-1/GI2–2 & 624 & + \\ \hline GI2* & GI2–3/GI2–4 & 902 & - \\ \hline GI3 & GI3–1/GI3–2 & 967 & + \\ \hline GI1+GI2 & GI2–3/GI1–2 & 1,175 & - \\ \hline GI2+GI3 & GI3-2/GI2-2 & 578 & + \\ \hline GI2*+GI3 & GI3-3/GI2–4 & 494 & - \\ \hline GI1–GI3 & GI3-2/GI1–2 & 720 & + \\ \hline GI4 & GI4-1/GI4-2 & 384 & + \\ \hline GI5 & GI5-1/GI5-2 & 571 & - \\ \hline GI6 & GI6-1/GI6-2 & 850 & + \\ \hline GI7 & GI7-1/GI7-2 & 384 & + \\ \hline \end{tabular} \end{table}
PMC2717098_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|} \hline \textbf{Designation} & \textbf{DNA-Sequence} \\ \hline GI1-1 & 5'-TAC GGA CCT TCT CGG CGG-3' \\ \hline GI1–2 & 5'-GAC CCA AGG CAA GAC GCT G-3' \\ \hline GI1–3 & 5'-ATT ACC CGC ATT CCC TTG TTG-3' \\ \hline GI2-1 & 5'-TCG TTG ACC TCG CTC CTC CA-3' \\ \hline GI2-2 & 5'-TAC GAC AGT TGA CCA CAG TTG-3' \\ \hline GI2–3 & 5'-CTC TGC CGT CCC TCC TTG-3' \\ \hline GI2–4 & 5'-TCA AGA CCA TCG TAT AGC GG-3' \\ \hline GI3-1 & 5'-AGG TCT AGG AAA ACT GGG CGA ATC-3' \\ \hline GI3-2 & 5'-GTA TTC CTG TGC CTA GAT TGG-3' \\ \hline GI3–3 & 5'-TCA GCC CCA GCA ACT ATC C-3' \\ \hline GI4-1 & 5'-ATG AAC ACC CGG CGA CCC-3' \\ \hline GI4-2 & 5'-GAG CTA ACC TAC TGT CCC AT-3' \\ \hline GI5-1 & 5'-GTT TTG GGA TGT TTT GAA GCG TG-3' \\ \hline GI5-2 & 5'-CGG TCG AAG AAG CCA GCA GT-3' \\ \hline GI6-2 & 5'-GAT AGG GTT CGC TCA CAC GGC-3' \\ \hline GI6-1 & 5'-CTC CTC CAG CAA CAA TAC GG-3' \\ \hline GI7-1 & 5'-TTG AGA CGA CTA TGA ACC CAG-3' \\ \hline GI7-2 & 5'-CGC CCA TTG CCA CGA CCG-3' \\ \hline Tet1 & 5'-GAC GGC GGC CGC ATC TGG CAA AGC-3' \\ \hline Tet2 & 5'-ATA CTA GTC ATC GCG TGA TCC TCG CGA A-3' \\ \hline Tet3 & 5'-ATG AAT TCA ATA CGC CCG AGA CCC GCG-3' \\ \hline Tet4 & 5'-CAT CTC GAG AAA ACG GTG AAG GCC AGC-3' \\ \hline tRNA45-1 & 5'-CCG TCT CCA ATC CCA AGG C-3' \\ \hline tRNA45-2 & 5'-CTG GAA CAA GAA GGC CG C-3' \\ \hline \end{tabular} \end{table}
PMC2717098_table_1
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|} \hline \textbf{MIC Mutant} & \textbf{Design Score} & \textbf{SEC Binding} \\ \hline N69Q_Q108L_Q120I_K154S_T155D & -8.1 & + \\ \hline N69Q_Q120I_K154S_T155D_Y157L & -7.1 & - \\ \hline N69Q_D72F_K154S_T155D & -7.1 & + \\ \hline N69Q_Q120I_K154S_T155D & -6 & + \\ \hline N69Q_D72F_Q108L_K152V_Y157L & -5.9 & + \\ \hline K152V_K154S_T155D_Y157L & -5.8 & + \\ \hline N69Q_K154D & -4.3 & + \\ \hline K154S_T155D & -4 & - \\ \hline K152V_K154S_T155D & -3.9 & - \\ \hline N69Q_D72F_Q108L & -3.9 & + \\ \hline N69Q_D72F & -3.6 & + \\ \hline N69Q & -2.8 & + \\ \hline K152V_Y157L & -2.2 & + \\ \hline K154D & -1.5 & + \\ \hline Q108L & -0.5 & + \\ \hline Wild-type & 0 & + \\ \hline D72W & 0.3 & - \\ \hline Q120I & 0.7 & + \\ \hline Q120I_K154M & 0.8 & n/a \\ \hline N69W & 1.8 & ++ \\ \hline N69W_K152E_K154S & 4.2 & ++ \\ \hline N69W_K152E_K154D & 4.3 & ++ \\ \hline K152E_K154M & 4.4 & + \\ \hline N69W_D72F_K152E & 4.5 & ++ \\ \hline N69W_D72W_K152E & 5.1 & + \\ \hline N69W_K152E & 5.5 & ++ \\ \hline \end{tabular} \end{table}
PMC2717102_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|} \hline \textbf{Origin} & \textbf{Sequence} & \textbf{Reference} \\ \hline Plasma proteins \\ \hline Complement factor C3 & LGEACKKVFLDCCNYITELRRQHARAS & [13,14] \\ \hline High molecular weight kininogen & HKHGHGHGKHKNKGKKNGKH & [15] \\ \hline Fibronectin & QPPRARITGYIIKYEKPG & [17] \\ \hline Protein C Inhibitor & SEKTLRKWLKMFKKRQLELY & [11] \\ \hline Histidine-rich glycoprotein & GHHPHGHHPHGHHPHGHHPH & [18,19] \\ \hline Extracellular proteins \\ \hline Amphiregulin & LKKNGSCKRGPRTHYGQKAIL & [17] \\ \hline Heparin-binding EGF-like growth factor & GKRKKKGKGLGKKRDPCLRKYK & [17] \\ \hline Fibroblast growth factor \\ \hline Hepatocyte growth factor & LKIKTKKVNTADQCANRCTRNKGL \\ \hline Vitronectin & AKKQRFRHRNRKGYR & [11] \\ \hline PRELP & QPTRRPRPGTGPGRRPRPRPRP & [17] \\ \hline Laminin chains & SRNLSEIKLLISQARK KDFLSIELFRGRVKV LGTRLRAQSRQRSRPGRWHKVSVRW RLRAQSRQRSRPGRWHKVSVRW & [11] \\ \hline \end{tabular} \end{table}
PMC2717103_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|} \hline \textbf{Causes} & \textbf{number} & \textbf{\%} \\ \hline $\geq$ BMI** 30 kg/m2 & 3 & 6.8 \\ \hline PEGs suture-free technique & 6 & 13.6 \\ \hline PEGs could not be performed \\ \hline Non dilatable stenosis & 26 & 59.1 \\ \hline Neoplasias affecting stomach & 3 & 6.8 \\ \hline Gastric ulcer perforation & 2 & 4.5 \\ \hline Patients with ascites & 2 & 4.5 \\ \hline Partial gastrectomy & 1 & 2.3 \\ \hline Respiratory failure associated to supine position & 1 & 2.3 \\ \hline \end{tabular} \end{table}
PMC2717113_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|} \hline \textbf{Variable} & \textbf{number} & \textbf{\%} \\ \hline Gender \\ \hline Male & 354 & 81.4 \\ \hline Female & 81 & 18.6 \\ \hline Baseline disease \\ \hline Head/Neck neoplasia & 346 & 79.5 \\ \hline Esophagus neoplasia & 74 & 17.0 \\ \hline Lung neoplasia & 9 & 2.1 \\ \hline Neurologic disease & 6 & 1.4 \\ \hline Indication \\ \hline Dysphagia & 346 & 79.5 \\ \hline Preoperative & 57 & 13.1 \\ \hline Salivary fistula & 22 & 5.1 \\ \hline Nasal regurgitation & 10 & 2.3 \\ \hline Minor complications \\ \hline Bleeding & 4 & 0.9 \\ \hline Respiratory failure & 3 & 0.7 \\ \hline Major complications \\ \hline Pneumoperitoneum & 2 & 0.5 \\ \hline Leakage & 2 & 0.5 \\ \hline Wound infection & 1 & 0.2 \\ \hline Mortality & 1 & 0.2 \\ \hline \end{tabular} \end{table}
PMC2717113_table_1
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|l|} \hline \textbf{Author [ref]} & \textbf{Year} & \textbf{Gastropexy} & \textbf{Antibiotics} & \textbf{N} & Infection (\textbf{N}) & \textbf{Infection (\%)} \\ \hline Russell TR [12] & 1984 & \textbf{N}o & \textbf{N}/A & 28 & 1 & 3.6 \\ \hline Hashiba K [19] & 1987 & Suture & \textbf{N}/A & 56 & 0 & 0.0 \\ \hline Kadota T [13] & 1991 & \textbf{N}o & \textbf{N}/A & 89 & 3 & 3.4 \\ \hline Robertson FM [18] & 1996 & Fogarty & Yes & 20 & 0 & 0.0 \\ \hline Tucker AT [16] & 2003 & T-fastener & Yes & 29 & 0 & 0.0 \\ \hline Maetani I [4] & 2003 & \textbf{N}o & Yes & 29 & 0 & 0.0 \\ \hline Dormann AJ [9] & 2006 & Suture & Yes & 46 & 1 & 2.2 \\ \hline Saito M [11] & 2007 & Suture & \textbf{N}/A & 82 & 0 & 0.0 \\ \hline Campoli PMO [8] & 2007 & Suture & \textbf{N}o & 142 & 4 & 2.8 \\ \hline Toyama Y [20] & 2007 & Suture & Yes & 30 & 1 & 3.3 \\ \hline Foster JM [17] & 2007 & T-fastener & \textbf{N}o & 149 & 5 & 3.4 \\ \hline Shastri YM [14] & 2008 & Suture & Yes & 47 & 1 & 2.1 \\ \hline Shastri YM [14] & 2008 & Suture & \textbf{N}o & 46 & 1 & 2.2 \\ \hline Horiuchi A [5] & 2008 & Suture & Yes & 68 & 0 & 0.0 \\ \hline Current series & 2008 & Suture & \textbf{N}o & 435 & 1 & 0.2 \\ \hline Pooled & & & & 1,296 & 18 & 1.4 [95\%CI: 0.9–2.2] \\ \hline \end{tabular} \end{table}
PMC2717113_table_2
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline \textbf{Characteristics} & \textbf{Population*} & \textbf{Episodes} & \textbf{Period prevalence (\%) [95\% CI]} \\ \hline & 1,004 & 170 & 16.9 [14.7–19.4] \\ \hline Gender \\ \hline Female & 524 & 89 & 17 [13.9–20.5] \\ \hline Male & 480 & 81 & 16.9 [13.6–20.5] \\ \hline Age group (Years) \\ \hline 0–4 & 139 & 28 & 20.1 [13.8–27.8] \\ \hline 5–9 & 131 & 9 & 6.9 [3.2–12.6] \\ \hline 10–14 & 112 & 10 & 8.9 [4.4–15.8] \\ \hline 15 + & 622 & 123 & 19.8 [16.7–23.1] \\ \hline \end{tabular} \end{table}
PMC2717114_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline \textbf{Alabama} & \textbf{0.309} & \textbf{Montana} & \textbf{0.277} \\ \hline Alaska & 0.226 & North Carolina & 0.31 \\ \hline Arkansas & 0.362 & North Dakota & 0.217 \\ \hline Arizona & 0.304 & Nebraska & 0.209 \\ \hline California & 0.27 & New Hampshire & 0.152 \\ \hline Colorado & 0.21 & New Jersey & 0.167 \\ \hline Connecticut & 0.18 & New Mexico & 0.32 \\ \hline District of Columbia & 0.288 & Nevada & 0.229 \\ \hline Delaware & 0.207 & New York & 0.28 \\ \hline Florida & 0.266 & Ohio & 0.235 \\ \hline Georgia & 0.264 & Oklahoma & 0.308 \\ \hline Hawaii & 0.185 & Oregon & 0.249 \\ \hline Iowa & 0.21 & Pennsylvania & 0.212 \\ \hline Idaho & 0.278 & Rhode Island & 0.217 \\ \hline Illinois & 0.228 & South Carolina & 0.3 \\ \hline Indiana & 0.233 & South Dakota & 0.234 \\ \hline Kansas & 0.231 & Tennessee & 0.288 \\ \hline Kentucky & 0.322 & Texas & 0.325 \\ \hline Louisiana & 0.336 & Utah & 0.25 \\ \hline Massachusetts & 0.212 & Virginia & 0.197 \\ \hline Maryland & 0.154 & Vermont & 0.19 \\ \hline Maine & 0.243 & Washington & 0.189 \\ \hline Michigan & 0.245 & Wisconsin & 0.187 \\ \hline Minnesota & 0.18 & West Virginia & 0.332 \\ \hline Missouri & 0.264 & Wyoming & 0.209 \\ \hline Mississippi & 0.413 \\ \hline \end{tabular} \end{table}
PMC2717116_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|} \hline \textbf{Prostasin} & \textbf{Healthy} & \textbf{Cases} \\ \hline & & Adenomas1 & & Carcinomas \\ \hline & & Mild/moderate dysplasia & Severe dysplasia \\ \hline & (n = 23) & (n = 93) & (n = 13) & (n = 116) \\ \hline Men & 9 & 68 & 7 & 59 \\ \hline Women & 14 & 25 & 6 & 57 \\ \hline Mean age +SD2 & 56.3 $\pm$ 4.6 & 57.3 $\pm$ 3.5 & 54.8 $\pm$ 3.1 & 68.7 $\pm$ 12.4 \\ \hline \end{tabular} \end{table}
PMC2717118_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|} \hline \textbf{Variable} & \textbf{mRNA level in normal tissue Mean (SD)} & \textbf{\textbf{Pa}} & \textbf{mRNA level in adenomas/ carcinomas Mean (SD)} & \textbf{\textbf{Pa}} & \textbf{Pb} \\ \hline Prostasin \\ \hline Healthy individuals & 0.96 (0.29) \\ \hline Mild/moderate & 1.10 (0.38) & NS & 0.62 (0.24) & NS & <0.001 \\ \hline Severe & 1.08 (0.46) & NS & 0.73 (0.50) & NS & <0.01 \\ \hline \multirow{2}{*}{Carcinoma distant adjacent} & 0.85 (0.65) & NS & 0.61 (0.60) & NS & <0.05 \\ \hline 0.90 (0.76) & NS & & & <0.01 \\ \hline All adenomas and carcinomas & 0.96 (0.61) & NS & 0.62 (0.48) & <0.05 & ND \\ \hline PN-1 \\ \hline Healthy individual & 0.022 (0.030) \\ \hline Mild/moderate & 0.015 (0.017) & NS & 0.041 (0.028) & NS & <0.001 \\ \hline Severe & 0.010 (0.003) & NS & 0.033 (0.031) & NS & <0.05 \\ \hline \multirow{2}{*}{Carcinoma distant adjacent} & 0.028 (0.027) & NS & 0.063 (0.060) & <0.001 & <0.001 \\ \hline 0.025 (0.018) & NS & & & <0.001 \\ \hline \end{tabular} \end{table}
PMC2717118_table_1
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|} \hline \textbf{Probeset typea} & \textbf{Number of probesets} \\ \hline Total number of probesets & 61115 \\ \hline Cross-hybridizing (_s_at,_x_at,_a_at) & 12704 \\ \hline Ambiguous orientation (A1) & 10643 \\ \hline Members of 5' (i.e. "prune") set & 32578 \\ \hline "High quality" probesets & 13822 \\ \hline \end{tabular} \end{table}
PMC2717122_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline \textbf{Gene} & \textbf{Forward primer} & \textbf{Reverse primer} & \textbf{Product size (bp)} \\ \hline ELF1 & CAGATTGGCAACGGCTACG & CGGACAGCAAAACGACCAAG & 227 \\ \hline GAPDH & TTCAACATCATTCCAAGCAGCA & CGTAACCCAAAATGCCCTTG & 220 \\ \hline Cyclophilin & CAAGCCGCTGCACTACAAGG & AGGGGACGGTGCAGATGAA & 227 \\ \hline Actin & GACAATGGAACCGGAATGGTC & GTGTGATGCCAGATTTTCTCCAT & 236 \\ \hline \end{tabular} \end{table}
PMC2717122_table_1
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|} \hline \textbf{Probeset} & \textbf{Forward primer} & \textbf{Reverse primer} & \textbf{Product size (bp)} \\ \hline Barley1 \\ \hline Contig8230 & TACATGCTCTTGTTTGGTGCTACTG & AAGGTAAGTAGGCAGCAGTGAAGGT & 204 \\ \hline Contig6943 & GGGGAAATCCCAGGTCGTCGAT & GGCTTGCTGCTAGGGTTTTCAG & 266 \\ \hline Contig7925 & CGAACCGTAGAATGTGTAAGGG & GGGAGGAAAGATACACGCTT & 114 \\ \hline Contig3031 & TTACTATGCTGGATATGGACAAGGG & TCTCATCTCATGTCTGGAAGACCC & 190 \\ \hline Contig4668 & CCCCCCACAAGTACCTGAAGA & CGTTGGCTTGCTTAGCTCTTCC & 286 \\ \hline Contig7671 & CTAAGCGACCTTGCATCTTTTGAC & AACGCTAGTGCTACTGGCAGGA & 213 \\ \hline Contig20269 & GAAGGCTCAGAAAGTTGCTGCTAT & GCAAAATCATTCACTGCTTCCAGAG & 224 \\ \hline Contig5740 & GAGGCTGTTCAGCAACTGGACTG & CAAGGATCCCAGCCACATACTG & 227 \\ \hline Contig15148 & GATCTCTTCGTGGTGGATCACATAC & GCTTGATGTCCTATGCTTTCCAA & 221 \\ \hline Contig11660 & ACCTCATCAACCTCTGCGGC & TTCCAGAGAACGGAGGCAGG & 210 \\ \hline Contig14399 & AGAAAGAGAGATTTTGAAGCTTGGC & AATCCATCGCCATGCCAACT & 213 \\ \hline Contig15147 & GGCGGGGCACTTTTGAGGACAT & CGAGCCTGCGACGGGTTATT & 182 \\ \hline Contig2400 & AAGCATGCCGCCATCCCGTT & CCCAACCTGACAACTCCACCTAGA & 244 \\ \hline Wheat \\ \hline Ta.3039.1 & ACGTCCATAACGATGGTCTTCATTG & GTAGTGGCCTCAGCATCACCATTGC & 170 \\ \hline Ta.13729.1 & TTTTCTACATGCTCTTGTTTGGTGC & AAAAGATCAACCCATGTGCTGCTCC & 265 \\ \hline Ta.27013.1 & CGAAGCGTGTATCTTTCCTC & CAGACACAAACGAAAATGAC & 183 \\ \hline Ta.7602.1 & AGCCCCCCACAAGTACCTGATGATG & GTCGTCATCCTCGTCACCATCTTCC & 201 \\ \hline Ta.27369.1 & TTACTATGCTGGATATGGACAAGGC & TGCTACAACATTAGCCTTGACAGTG & 230 \\ \hline Ta.9536.1 & GCCCTAAACGACCTTGCATCTTTTG & AAACTGAAGCACTAACCTACGACGC & 236 \\ \hline Ta.968.1 & ATGTGCTGCGTCGTCAGATACATAG & TACCCTCCTCGACTTCCTTGTGATC & 204 \\ \hline Ta.4425.1 & GATGCCATCAGATCCTCCAATT & GCCACTCCGTTGTGTCATAATATGG & 235 \\ \hline Ta.27038.1 & CGAAGCGTGTATCTTTCCTC & CAGACACAAACGAAAATGAC & 151 \\ \hline Ta.7256.1 & CATCTCATGGTACCTGACTGTCGA & GCAACAGACTGCCACCAGCA & 264 \\ \hline TaAffx.46790.1 & TCATGTCAGTTTATTGCAAGG & CAGTGACACTATAACAATACAGTTCT & 240 \\ \hline TaAffx.128707.1 & GAAAAGGTTGTAGTTCAGAAGG & TTGCTCTGGACTACTGTCTTC & 259 \\ \hline \end{tabular} \end{table}
PMC2717122_table_2
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|l|} \hline & & & \textbf{\% Frequency} & & \multicolumn{2}{c|}{\textbf{Fisher’s exact}} \\ \hline \textbf{Genes} & \textbf{Method} & \textbf{PT} & \textbf{PN} & \textbf{NN} & \textbf{ap value} & \textbf{bp value} \\ \hline B4GALT1 & C-MSP & 100 (5/5) & 0 (0/5) & 0 (0/5) & 0.008* & 0.008*! \\ \hline C10orf119 & SEQ & 0 (0/10) & 0 (0/10) & 0/10 & n/a & n/a \\ \hline COPS4 & SEQ & 0 (0/5) & 0 (0/5) & 0 (0/5) & n/a & n/a \\ \hline CSRP1 & SEQ & 50 (3/6) & 90 (9/10) & 100 (5/5) & 0.118 & 0.182 \\ \hline DARS & SEQ & 22 (2/9) & 40 (4/10) & 40 (4/10) & 0.628 & 0.628 \\ \hline FKBP14 & SEQ & 0 (0/5) & 0 (0/5) & 0 (0/4) & n/a & n/a \\ \hline FN3KRP & SEQ & 100 (5/5) & 100 (5/5) & 100 (5/5) & n/a & n/a \\ \hline FLJ20277 & SEQ & 100 (5/5) & 100 (5/5) & 100 (5/5) & n/a & n/a \\ \hline HUS1 & SEQ & 22 (2/9) & 0 (0/5) & 0 (0/5) & 0.505 & 0.505 \\ \hline KLF11 & SEQ & 100 (6/6) & 100 (6/6) & 100 (6/6) & n/a & n/a \\ \hline MYBL2 & SEQ & 100 (9/9) & 70 (7/10) & 100 (5/5) & 0.6 & n/a \\ \hline MRPL4 & SEQ & 100 (5/5) & 100 (5/5) & 100 (5/5) & n/a & n/a \\ \hline MYLK & SEQ & 10 (1/10) & 0 (0/10) & 0 (0/10) & 1.000 & 1.000 \\ \hline OSMR & C-MSP & 100 (5/5) & 33 (1/3) & 0 (0/5) & 0.107 & 0.008*! \\ \hline PAPSS2 & SEQ, C-MSP & 100 (5/5) & 20 (1/5) & 0 (0/5) & 0.048* & 0.008*! \\ \hline RBMS2 & SEQ & 100 (10/10) & 100 (7/7) & 100 (10/10) & n/a & n/a \\ \hline SECTM1 & SEQ & 0 (0/5) & 0 (0/5) & 0 (0/5) & n/a & n/a \\ \hline SIRT7 & SEQ & 100 (4/4) & 100 (5/5) & 100 (3/3) & n/a & n/a \\ \hline SLC39A4 & SEQ, C-MSP & 67 (6/9) & 100 (6/6) & 100 (10/10) & 0.229 & 0.087 \\ \hline SLC9A3R1 & C-MSP & 100 (5/5) & 100 (5/5) & 100 (5/5) & n/a & n/a \\ \hline TUBG2 & SEQ, C-MSP & 71 (5/7) & 40 (2/5) & 0 (0/5) & 0.558 & 0.028*! \\ \hline NTRK2 & C-MSP & 100 (5/5) & 20 (1/5) & 0 (0/5) & 0.048* & 0.008*! \\ \hline SFRP4 & C-MSP & 100 (5/5) & 0 (0/5) & 0 (0/5) & 0.008* & 0.008*! \\ \hline \end{tabular} \end{table}
PMC2717211_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|} \hline & \multicolumn{3}{c|}{\textbf{SFRP1}} & \multicolumn{3}{c|}{\textbf{B4GALT1}} & \multicolumn{3}{c|}{\textbf{OSMR}} & \multicolumn{3}{c|}{\textbf{SFRP1}+\textbf{OSMR}d} \\ \hline \textbf{Clinical features} & \textbf{\textbf{\textbf{\textbf{(+) M}}}} & \textbf{\textbf{\textbf{\textbf{\%}}}} & \textbf{\textbf{\textbf{\textbf{P value}}}} & \textbf{\textbf{\textbf{\textbf{(+) M}}}} & \textbf{\textbf{\textbf{\textbf{\%}}}} & \textbf{\textbf{\textbf{\textbf{P value}}}} & \textbf{\textbf{\textbf{\textbf{(+) M}}}} & \textbf{\textbf{\textbf{\textbf{\%}}}} & \textbf{\textbf{\textbf{\textbf{P value}}}} & \textbf{\textbf{\textbf{\textbf{(+) M}}}} & \textbf{\textbf{\textbf{\textbf{\%}}}} & \textbf{\textbf{\textbf{\textbf{P value}}}} \\ \hline Non-CRC/Non-ADa & 0/15 & 0 & e0.001* & 2/10 & 20 & e0.109 & 0/15 & 0 & e0.004* & 0/15 & 0 & e,0.001* \\ \hline CRCb & 11/20 & 55 & & 9/16 & 56 & & 9/20 & 45 & & 12/20 & 60 \\ \hline ADc & 5/17 & 29 & f0.185 & & n/a & & 2/16 & 13 & f0.067 & 6/17 & 35 & f0.191 \\ \hline \end{tabular} \end{table}
PMC2717211_table_1
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|} \hline \textbf{Clinical features} & \textbf{(+) M} & \textbf{\%} & \textbf{eP value} & \textbf{fP value} \\ \hline Controlsa & 4/81 & 5 \\ \hline CRCb \\ \hline Total & 26/69 & 38 & ,0.001* \\ \hline Stagec I & 2/18 & 11 & 0.299 \\ \hline II & 15/27 & 56 & ,0.001* \\ \hline III & 8/18 & 44 & ,0.001* \\ \hline IV & 1/6 & 17 & 0.307 \\ \hline controlsd Confounding & 7/41 & 17 & & 0.031 \\ \hline \end{tabular} \end{table}
PMC2717211_table_2
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|} \hline \textbf{Tissues} & \textbf{Expression} & \textbf{Tumor Grade} \\ \hline Colon Cancer \\ \hline 1 & - & III \\ \hline 2 & - & III \\ \hline 3 & - & III \\ \hline 4 & + & III \\ \hline 5 & + & II \\ \hline 6 & - & II \\ \hline 7 & - & II \\ \hline 8 & - & I \\ \hline 9 & + & I \\ \hline 10 & + & I \\ \hline Non-malignant normal colon \\ \hline 1 & ++ \\ \hline 2 & ++++ \\ \hline 3 & ++++ \\ \hline 4 & ++++ \\ \hline 5 & ++++ \\ \hline 6 & ++++ \\ \hline Cancer adjacent normal colon \\ \hline 1 & ++++ \\ \hline 2 & ++++ \\ \hline 3 & ++++ \\ \hline 4 & ++++ \\ \hline 5 & ++++ \\ \hline 6 & ++++ \\ \hline 7 & ++++ \\ \hline 8 & ++++ \\ \hline \end{tabular} \end{table}
PMC2717211_table_3
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|} \hline & \multicolumn{2}{c|}{\textbf{Among Total Sample}} & \multicolumn{3}{c|}{\textbf{Among Ideators}} \\ \hline \textbf{DSM-IV Disorders} & \textbf{Ideation} & \textbf{Attempt} & \textbf{Plan} & \textbf{Plan}ned \textbf{Attempt} & Unplanned \textbf{Attempt} \\ \hline Any mood disorder & 0.620 & 0.586 & 0.007 & 0.073 & 0.056 \\ \hline Any anxiety disorder & 0.293 & 0.326 & 0.015 & 0.086 & 0.045 \\ \hline Any impulse disorder & 0.072 & 0.064 & 0.003 & 0.009 & 0.029 \\ \hline Any substance disorder & 0.132 & 0.135 & 0.015 & 0.022 & 0.064 \\ \hline Any disorder & 0.761 & 0.753 & 0.047 & 0.187 & 0.176 \\ \hline (n)a & (27,963) & (27,963) & (4,997) & (1,874) & (3,123) \\ \hline \end{tabular} \end{table}
PMC2717212_table_0
\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{|l|l|l|l|l|l|} \hline & \multicolumn{2}{c|}{\textbf{Among Total Sample}} & \multicolumn{3}{c|}{\textbf{Among Ideators}} \\ \hline \textbf{DSM-IV Disorders} & \textbf{Ideation} & \textbf{Attempt} & \textbf{Plan} & \textbf{Plan}ned \textbf{Attempt} & Unplanned \textbf{Attempt} \\ \hline Any mood disorder & 0.421 & 0.400 & 20.021 & 0.008 & 20.031 \\ \hline Any anxiety disorder & 0.217 & 0.231 & 0.010 & 0.024 & 0.079 \\ \hline Any impulse disorder & 0.111 & 0.097 & 0.007 & 0.009 & 0.023 \\ \hline Any substance disorder & 0.114 & 0.098 & 0.009 & 0.013 & 0.034 \\ \hline Any disorder & 0.609 & 0.592 & 0.003 & 0.055 & 0.102 \\ \hline (n)a & (26,959) & (26,959) & (3,326) & (1,438) & (1,888) \\ \hline \end{tabular} \end{table}
PMC2717212_table_1
End of preview. Expand in Data Studio
README.md exists but content is empty.
Downloads last month
9